processes to produce lipids

专利摘要:
Processes for producing lipids The present invention relates to methods of producing lipids. in particular, the present invention relates to methods for increasing the level of one or more non-polar lipids and/or the total non-polar lipid content in a vegetative plant part or a transgenic organism or part thereof.
公开号:BR112014015921A2
申请号:R112014015921-1
申请日:2012-12-21
公开日:2021-05-25
发明作者:Thomas Vanhercke；James Robertson Petrie；Anna El Tahchy；Surinder Pal Singh；Qing Liu
申请人:Commonwealth Scientific And Industrial Research Organisation；
IPC主号:

专利说明:

[1] [1] The present invention relates to methods of producing lipids. In particular, the present invention relates to methods for increasing the level of one or more non-polar lipids and/or the content of total non-polar lipids, in a transgenic organism or part thereof. In a particular embodiment, the present invention relates to any combination of one or more monoacylglycerol acyltransferases (MGATS), diacylglycerol acyltransferases (DGATS), glycerol-3-phosphate acyltransferaases (GPATS), oil body proteins and/or transcription factors regulating lipid biosynthesis while silencing key enzymatic steps in starch biosynthesis and fatty acid desaturation pathways to increase the level of one or more nonpolar lipids and/or total nonpolar lipid content and/or monounsaturated fatty acid content in plants or any part thereof including plant seed and/or leaves, algae and fungi. Wt,e,ceden,t,e.s_of the invention
[2] [2] Most of the world's energy, particularly for transportation, is provided by petroleum-based fuels which have a finite source. Alternative sources which are renewable are needed, such as from biologically produced oils. Triacylglycerol Biosynthesis
[3] [3] Triacliglycerols (TAG) constitute the major form of lipid in seeds and consist of three acyl chains esterified to a glycerol backbone. Fatty acids are synthesized in the plastid as acyl-acyl carrier protein (ACP) intermediates when they can undergo a first catalyzed desaturation. This reaction is catalyzed by stearoyl-ACP desaturase and yields oleic acid (C18:1l9).
[4] [4] TAG biosynthesis via the Kennedy pathway consists of a series of subsequent acylations, each using acyl-CoA reductase esters as the acyl donor. The first acylation step normally occurs at the snl position of the G3P structure and is catalyzed by glycerol-3-phosphate acyltransferase (snl-GPAT). The product, snl-lysophosphatidic acid (sn1-LPA) serves as a substrate for lysophosphatidic acid acyltransferase (LPAAT) which couples a second acyl chain at the sn2 position to form phosphatidic acid. PA is further dephosphorylated from diacylglycerol (DAG) by phosphatidic acid phosphatase (PAP), thus providing the substrate for the last acylation step. Finally, a third acyl chain is esterified to the sn3 position of DAG, in a reaction catalyzed by diacylglycerol acyltransferase (DGAT) to form TAG that accumulates in oil bodies. A second enzymatic reaction, phosphatidyl glycerol acyltransferase (PDAT), also results in the conversion of DAG to TAG. This reaction is unrelated to DGAT and uses phospholipids as acyl donors.
[5] [5] To maximize yield for the commercial production of lipids, there is a need for additional means to increase lipid levels, in particular nonpolar lipids such as DAG and TAG, in transgenic organisms or parts thereof such as plants, seeds, leaves , algae and fungi. Attempts to increase the production of neutral lipids in plants have focused mainly on individual critical enzymatic steps involved in fatty acid biosynthesis or TAG labeling. These strategies, however, resulted in a modest increase in seed or leaf oil content. Recent metabolic engineering work on the oleaginous yeast Yarrowia lipolytica has demonstrated that a combined approach to increase glycerol-3-phosphate production and prevent tag breakage via j3-oxidation resulted in cumulative increases in total lipid content (Dulermo et al., 2011 ).
[6] [6] Plant lipids such as seed oil triacylglycerols (TAGs) have many uses, for example, culinary uses (reductions, texture, flavor), industrial uses (in soaps, candles, perfumes, cosmetics, suitable as drying agents, insulators, lubricants) and provide nutritional value. There is also a growing interest in the use of plant lipids for biofuel production.
[7] [7] To maximize yield for commercial lipid production, there is a need for additional means to increase lipid levels, in particular nonpolar lipids such as DAG and TAG, in transgenic organisms or parts thereof such as plants, seeds, leaves , algae and fungi. SUMMARY OF THE INVENTION
[8] [8] The present inventors have demonstrated a significant increase in the lipid content of organisms, particularly in the vegetative parts and seeds of plants, by manipulating both fatty acid biosynthesis and lipid assembly pathways. Various combinations of genes were used to achieve substantial increases in oil content, which is of great importance for the production of biofuels and other industrial oil-derived products.
[9] [9] In a first aspect, the invention provides a process for producing an industrial product from a vegetative plant part or non-human organism or part thereof comprising high levels of non-polar lipids.
[10] [10] In one embodiment, the invention provides a process for producing an industrial product, the process comprising the steps of: i) obtaining a vegetative plant part having a total non-polar lipid content of at least about 3%, of preferably at least about 5% or less about 7% (w/w dry weight), ii) converting at least some of the lipids in situ in the vegetative plant part to the industrial product by thermal, chemical or enzymatic means, or any combination thereof, and iii) recovering the industrial product, thereby producing the industrial product.
[11] [11] In another embodiment, the process for producing an industrial product comprises the steps of: i) obtaining a vegetative plant part having a total non-polar lipid content of at least about 3%, preferably at least about 5 % or at least about 7% (w/w dry weight), ii) physically processing the vegetative plant part from step i), iii) converting at least some of the lipids in the processed vegetative plant part to the industrial product by applying inites thermal, chemical or enzymatic, or any combination thereof, to the lipid in the processed vegetative plant part, and iv) recovering the industrial product, thereby producing the industrial product.
[12] [12] In another modality, the process to produce an industrial product comprises the steps of: i) obtaining a non-human organism or a part thereof that comprises one or more exogenous polynucleotides, in which each of the one or more exogenous polynucleotides are operatively linked to a promoter which is capable of directing the expression of the polynucleotide in a non-human organism or a part thereof, and wherein the non-human organism or part thereof has an increase in the level of one or more non-polar lipids with respect to a corresponding non-human organism or a part thereof lacking one or more exogenous polynucleotides, and ii) converting at least some of the lipids in situ in the non-human organism or part thereof to the industrial product by thermal, chemical or enzymatic means, or any combination thereof, and iii) recover the industrial product, thereby producing the industrial product.
[13] [13] In another modality, the process to produce an industrial product comprises the steps of: i) obtaining a non-human organism or a part thereof comprising one or more exogenous polynucleotides, in which the non-human organism or part thereof has an increase in the level of one or more non-polar lipids relative to a corresponding non-human organism or a part thereof lacking one or more exogenous polynucleotides, ii) physically processing the non-human organism or part thereof from step i), iii) convert at least some of the lipids in the transformed non-human organism or part thereof to the industrial product through the application of thermal, chemical, or enzymatic means, or any combination thereof, to the lipid in the non-human organism or part thereof, and iv) recover the industrial product, thus producing the industrial product.
[14] [14] In each of the above embodiments, it would be understood by a person skilled in the art that the conversion step can be performed simultaneously with or subsequent to the physical processing step.
[15] [15] In each of the above modalities, the total nonpolar lipid content of the vegetative plant part, or non-human organism or part thereof, preferably a plant leaf or part thereof, stem or tuber, is at least about 3°5, more preferably at least about 5°5, preferably at least about 7%, more preferably at least about 10%, more preferably at least about 11°, most preferably at least about 12%, more preferably at least about 13%, more preferably at least about 14%, or more preferably at least about 15% (w/w dry weight). In another preferred modality, the total non-polar lipid content is between 5% and 25%, between 7% and 25%, between 10% and 25%, between 12% and 25%, between 15% and 25%, between 7% and 20%, between 10% and 20%, between 10% and 15%, between 15% and 20%, between 20% and 25%, about 10%, about 11%, about 12%, about 13 %, about 14%, about 15%, about 16%, about 17%, about 18%, about 20%, or about 22% each, as a percentage of dry weight. In a particularly preferred embodiment, the vegetative plant part is a leaf (or leaves) or a portion thereof. In a more preferred embodiment, the vegetative plant part is a leaf portion having a surface area of at least 1 cm2.
[16] [16] Furthermore, in each of the above modalities, the total TAG content of the vegetative plant part, or non-human organism or part thereof, preferably a plant leaf or part thereof, stem or tuber, is, at least about 35%, more preferably at least about 5%, preferably at least about 7.5, more preferably at least about 10%, more preferably at least about 11%, most preferably at least about 12%, more preferably at least about 13%, more preferably at least about 14%, more preferably at least about 15%, or most preferably at least about 17% (w/w dry weight). In another preferred modality, the total TAG content is between
[17] [17] The industrial product can be an intermediate product, for example, a product comprising fatty acids, which can later be converted, for example,
[18] [18] Heat can be applied in the process, such as by combustion pyrolysis, gasification, or in conjunction with enzymatic digestion (including anaerobic digestion, composting, fermentation). Low temperature gasification occurs, for example, between about 700°C to about 1000°C. Higher gassing temperature occurs, for example, between about 1200°C to about 1600°C. Low pyrolysis temperature (slow pyrolysis) occurs, for example, at around 400°C, while the highest pyrolysis temperature occurs at, for example, around 500°C. Mesophilic digestion takes place between, for example, about 20°C and about 40°C. Thermophilic digestion occurs from, for example, about 50°C to about 65°C.
[19] [19] Chemical means include, but are not limited to, catalytic cracking, anaerobic digestion, fermentation, composting, and transesterification. In one embodiment, a chemical medium uses a catalyst or mixture of catalysts, which can be applied in conjunction with heat. The process can use a homogeneous catalyst, a heterogeneous catalyst and/or an enzymatic catalyst. In one embodiment, the catalyst is a transition metal catalyst, a molecular sieve type catalyst, an activated alumina catalyst, or sodium carbonate. Catalysts include acid catalysts such as sulfuric acid, or alkaline catalysts such as potassium or sodium hydroxide or other hydroxides. The chemical means can comprise transesterification of fatty acids in the lipid, a process that can use a homogeneous catalyst, a heterogeneous catalyst and/or an enzymatic catalyst. The conversion may comprise pyrolysis, which applies heat and may be applied from chemical means, and may use a transition metal catalyst, a molecular sieve type catalyst, an activated alumina catalyst and/or sodium carbonate.
[20] [20] Enzymatic means include, but are not limited to, digestion by microorganisms, eg, anaerobic digestion, fermentation or composting, or by recombinant enzyme proteins.
[21] [21] The lipid that is converted to an industrial product, in this aspect of the invention, there may be some, or all, of the non-polar lipid in the part of the vegetative plant or non-human organism or a part thereof, or preferably, the conversion is of at least some of the non-polar lipids and at least some of the polar lipids, and more preferably essentially all of the lipid (both polar and non-polar), in the part of the vegetative plant or non-human organism or a part of it is converted to O (S) industrial product(s).
[22] [22] In one embodiment, the conversion of the lipid to the industrial product occurs in situ, without physical disruption of the vegetative plant part or non-human organism or part thereof. In this modality, the vegetative plant part or non-human organism or part thereof may first be dried, for example, by the application of heat, or the vegetative plant part or non-human organism or part thereof may be used essentially as harvested, without drying. In an alternative modality, the process comprises a step of physically processing part of the vegetative plant, or the non-human organism or part of it. Physical processing may comprise one or more of lamination, pressing, such as peeling, crushing or grinding the vegetative plant part, non-human organism or part thereof, which can be combined with drying the vegetative part, or the non-human organism or part of the same. For example, the vegetative plant part, or non-human organism or part thereof may first be substantially dried and then ground to a finer material for ease of subsequent processing.
[23] [23] In one modality, the weight of the vegetative plant part, or the non-human organism or a part of it used in the process is at least 1 kg or, preferably, at least 1 ton (dry weight) of vegetative parts or non-human organisms or parts thereof. The processes may further comprise a first step of vegetatively harvested plant parts, for example, from at least 100 or 1000 plants grown in a carnpo, to provide a set of at least 1000 said vegetative parts, i.e. is, that they are essentially identical. Preferably, the vegetative parts are harvested at the time when the nonpolar lipid yields are the highest. In one modality, the vegetative parts are harvested over the flowering time. In another modality, the vegetative parts are harvested from around, at the time of flowering until around the beginning of senescence. In another modality, the vegetative parts are harvested when the plants are at least about 1 month old.
[24] [24] The process may or may not yet comprise extracting some of the non-polar lipid content of the vegetative plant part, or the non-human organism or part of it, prior to a step conversion. In one embodiment, the process further comprises the steps of: (a) extracting at least a portion of the non-polar lipid content from the vegetative plant part or the non-human organism or part thereof as non-polar lipid, and (b) recovering the extracted non-polar lipid, in which steps (a) and (b) are carried out before the step of converting at least some of the lipids in the vegetative plant part, or the non-human organism or a part of it to the industrial product . The proportion of non-polar lipid that is extracted first may be less than 50%, or more than 50%, or preferably at least 75% of total non-polar lipid from the vegetative plant part, or non-human organism or part the same. In this embodiment, the extracted nonpolar lipid comprises triacylglycerols, wherein the triacylglycerols comprise at least 90%, preferably at least 95% of the extracted lipid. The extracted lipid itself can be converted to an industrial product other than the lipid itself, for example, by transesterification of fatty acid esters
[25] [25] In a second aspect, the invention provides a process for the production of lipid extracted from a non-human organism or a part thereof.
[26] [26] In one embodiment, the invention provides a process for the production of extracted lipids, the process comprising the steps of: i) obtaining a non-human organism or a part thereof comprising one or more exogenous polynucleotides and an increase in level of one or more non-polar lipids with respect to a corresponding non-human organism or a part thereof, respectively, lacking one or more exogenous polynucleotides, ii) extracting lipids from the non-human organism or part thereof, and iii) recovering the extracted lipid , thus producing the extracted lipid, in which each of the one or more exogenous polynucleotides is operably linked to a promoter that is capable of directing the expression of the polynucleotide in a non-human organism or part thereof, and in which one or more or all of the following features apply: (a) the one or more exogenous polynucleotides comprise a first exogenous polynucleotide encoding an RNA or poly transcription factor a peptide that increases the expression of one or more fatty acid or glycolitic acid biosynthesis genes in a non-human organism or a part thereof, and a second exogenous polynucleotide that encodes an RNA or a polypeptide involved in the biosynthesis of one or more nonpolar lipids , (b) if the non-human organism is a plant, a part of the vegetative plant has a total nonpolar lipid content of at least about 3°C, more preferably at least about 5%, preferably at least about 7% , more preferably at least about 10%, more preferably at least about 11%, more preferably at least about 12%, more preferably at least about 13%, more preferably at least about 14%, or more preferably at least about 13%. minus about 15% (w/w dry weight), (C) the non-human organism is an algae selected from the group consisting of diatoms (bacillaryophytes), green algae (chlorophytes), blue-green algae (cia nophiceous), golden brown algae (chrysophytes), haptophytes, brown algae and heterokont algae, (d) the one or more nonpolar lipids comprise a fatty acid comprising a hydroxyl group, an epoxy group, a cyclopropane group, a double bond carbon-carbon, a carbon-carbon triple bond, conjugated double bonds, a branched chain such as a methylated or hydroxylated branched chain, or a combination of two or more of these, or any one of two, three, four, five or six of the aforementioned groups, bonds or branched chains, (e) the total content of fatty acids in non-polar lipids comprises at least 2% more oleic acid and/or at least 2% less palmitic acid than the non-polar lipids in the corresponding a non-human organism or part thereof lacking one or more exogenous polynucleotides, (f) the non-polar lipids comprise a modification level of total sterols, preferably sterol-free (non-esterified), sterol-esters. teroyl, sterol glycosides, in relation to non-polar lipids in the corresponding non-human organism or part thereof lacking one or more exogenous polynucleotides, (g) non-polar lipids comprise waxes and/or wax esters, (h) the organism does not human or part thereof is a member of a clustered population or collection of at least 1000 such non-human organisms or parts thereof, respectively, from which the lipid is extracted.
[27] [27] In a modality of (b) above, the total non-polar lipid content is between 5°5 and 25%, between 7% and 25%, between 10% and 25%, between 12% and 25%, between 15 % and 25%, between 7% and 20%, between 10% and 20%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 20%, or about 22% each were a percentage of the dry weight.
[28] [28] In one embodiment, the non-human organism is an alga, or an organism suitable for fermentation, such as a fungus, or preferably a plant. The non-human part of the organism can be a seed, fruit, or a vegetative part of a plant. In a preferred embodiment, the plant part is a leaf part having a surface area of at least 1 cm2.
[29] [29] In one embodiment, the non-human organism is an oil fungus such as an oil yeast.
[30] [30] In a preferred modality, the lipid is extracted without drying from the non-human organism or part of it, prior to extraction. The extracted lipid can later be dried or fractionated to reduce its moisture content.
[31] [31] In other embodiments of this aspect, the invention provides a process for the production of lipids extracted from specific oil plants. In one embodiment, the invention provides a process for producing extracted canola oil, the process comprising the steps of: i) obtaining canola seeds comprising at least 45% seed oil on a weight basis, ii ) extracting canola seed oil, and iii) recovering the oil, wherein the recovered oil comprises at least 90% (w/w) triacylglycerols (TAG), thereby producing the canola oil. In a preferred embodiment, the canola seed has an oil content on a weight basis of at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55% or at least 56%. The oil content is determinable by measuring the amount of oil that is extracted from the seed, which is the shelled seed as commonly harvested, and calculated as a percentage of the seed weight, ie % (w/w). The moisture content of canola seed is between 5% and 15%, and is preferably about 8.5%. In one embodiment, the oleic acid content is between about 58% and 62% of the total fatty acids in the canola oil, preferably at least 63%, and the palmitic acid content is from about 4% to about of 6% of the total fatty acids in canola oil. The preferred canola oil has an iodine value of 110-120 and a chlorophyll level of less than 30 ppm.
[32] [32] In another embodiment, the invention provides a process for the production of extracted corn oil, the process comprising the steps of: i) obtaining corn seeds that comprise at least 5% seed oil on a base in weight, ii) extracting corn seed oil, and iii) recovering the oil, wherein the recovered oil comprises at least 80%, preferably at least 85% or at least 90% (w/w) triacylglycerols (TAG ), thus producing corn seed oil. In a preferred embodiment, the corn seed has an oil content based on seed weight (w/w) of at least 6%, at least 7%, at least 8°5, at least 9°5, at least 10%, at least 11%, at least 12% or at least 13%. The moisture content of corn seed is about 13% to about 17%, preferably about 15%. Preferred corn oil comprises about 0.1% tocopherols.
[33] [33] In another embodiment, the invention provides a process for the production of extracted soybean oil, the process comprising the steps of: i) obtaining soybean seeds comprising at least 20% seed oil on a base in weight, ii) extracting oil from the soybean seed, and iii) recovering the oil, wherein the recovered oil comprises at least 90% (w/w) triacylglycerols (TAG), thus producing the soybean oil. In a preferred embodiment, the soybean seed has an oil content based on seed weight (w/w) of at least 21%, at least 22%, at least 23%, at least 24%, at least 25% , at least 26%, at least 27%, at least 28%; at least 29%, at least 30%, or at least 31%. In one embodiment, the oleic acid content is between about 20% and about 25% of the total fatty acids in the soybean oil, preferably at least 30%, the linoleic acid content is between about 45% and about 57%, preferably less than 45%, and the palmitic acid content is about 10% to about 15% of the total fatty acids in the soybean oil, preferably less than 10%. Preferably the soybean seed has a protein content of about 40% on a dry weight basis, and the moisture content of the soybean seed is from about 10% to about 16%, preferably about 13%.
[34] [34] In another embodiment, the invention provides a process for producing extracted lupine oil, the process comprising the steps of: i) obtaining lupine seeds comprising at least 10% seed oil on a weight basis , ii) extracting oil from the lupine seeds, and iii) recovering the oil, wherein the recovered oil comprises at least 90% (w/w) triacylglycerols (TAG), thus producing the lupine oil. In a preferred embodiment, the lupine seed has an oil content based on seed weight (w/w) of at least 11%, at least 12%, at least 13%, at least 14%, at least 15 %, or at least 16%.
[35] [35] In another embodiment, the invention provides a process for producing extracted peanut oil, the process comprising the steps of: i) obtaining peanuts comprising at least 50% seed oil on a weight basis, ii ) extracting oil from the peanuts, and iii) recovering the oil, wherein the recovered oil comprises at least 90% (w/w) triacylglycerols (TAG), thereby producing the peanut oil. In a preferred embodiment, the peanut (peanut) seed has an oil content based on seed weight (w/w) of at least 51%, at least 52%, at least 53%, at least 54%, at least less than 55% or,
[36] [36] In another embodiment, the invention provides a process for producing extracted sunflower oil, the process comprising the steps of: i) obtaining sunflower seeds comprising at least 50% Seed oil on a weight basis , ii) extracting sunflower seed oil, and iii) recovering the oil, wherein the recovered oil comprises at least 90% (w/w) triacylglycerols (TAG), thus producing the sunflower oil. In a preferred embodiment, the sunflower seed has an oil content based on seed weight (w/w) of at least 51%, at least 52%, at least 53%, at least 54%, or at least , 55%.
[37] [37] In another embodiment, the invention provides a process for producing extracted cottonseed oil, the process comprising the steps of: i) obtaining cottonseed comprising at least 41% seed oil in a base by weight, ii) extracting cottonseed oil, and iii) recovering the oil, wherein the recovered oil comprises at least 90% (w/w) triacylglycerols (TAG), thus producing the cottonseed oil. cotton. In a preset modality, the cottonseed has an oil content based on seed weight (w/w) of at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, or at least 50%. In one embodiment, the oleic acid content is between about 15% and 22% of the total fatty acids in cottonseed oil, preferably at least 22%, the linoleic acid content is between about 45% and about 57%, preferably less than 45%, and the palmitic acid content is about 20% to about 26% of the total fatty acids in the cottonseed oil, preferably less than 18%. In one embodiment, cottonseed oil also contains fatty acids such as cyclopropane sterculic and malvalic acids, and may contain small amounts of gossypol.
[38] [38] In another embodiment, the invention provides a process for producing extracted flax seed oil, the process comprising the steps of: i) obtaining flax seed comprising at least 36% seed oil in a base by weight, ii) extracting linseed oil, and iii) recovering the oil, wherein the recovered oil comprises at least 90% (w/w) triacylglycerols (TAG), thus producing the linseed oil. linen. In a preferred embodiment, the flax seed has an oil content based on seed weight (w/w) of at least 37%, at least 38%, at least 39%, or at least 40%.
[39] [39] In another embodiment, the invention provides a process for the production of extracted camelina oil, the process comprising the steps of: i) obtaining seeds of Camelina sativa comprising at least 36% seed oil in a base weight, ii) extracting Camelina sativa seed oil, and iii) recovering the oil, wherein the recovered oil comprises at least 90% (w/w) triacylglycerols (TAG), thus producing the oil of Camelina. In a preferred embodiment, Camelina sativa seed has an oil content based on seed weight (w/w) of at least 37%, at least 38%, at least 39%, at least 40%, at least 41 %, at least 42%, at least 43%, at least 44%, or at least 45%.
[40] [40] The process of the second aspect may also comprise measuring the oil and/or protein content of the seed by near infrared reflectance spectroscopy, as described in Hom et al. (2007).
[41] [41] In one embodiment, the process of the second aspect of the invention comprises partially or completely drying the part of the vegetative plant, or the non-human organism, or part thereof, or the seed, and/or one or more of the larmination, pressing, such as flaking, crushing or grinding the part of the vegetative plant, or the non-human organism or part thereof, or the seed, or any combination of these methods, in the extraction process. The process may use an organic solvent (eg hexane such as n-hexane or a combination of n-hexane with iso-hexane, or butane alone or in combination with hexane) in the extraction process to extract the lipid or oil, or to increase the efficiency of the extraction process, particularly in combination with a drying process before reducing the moisture content.
[42] [42] In one embodiment, the process comprises recovering the extracted lipid or oil, collecting it in a container, and/or purifying the extracted lipid or seed oil, such as by degumming, deodorizing, discoloring, drying and /or fractionation of extracted lipid or oil, and/or removal of at least some, preferably substantially all, waxes and/or wax esters of extracted lipid or oil. The process may comprise analyzing the fatty acid composition of the extracted lipid or oil, such as by converting the fatty acids into the extracted lipid or fatty acid methyl ester oil and analyzing these using GC to determine the composition of fatty acids. The fatty acid composition of lipid or oil is determined before any fractionation of the lipid or oil, which alters its fatty acid composition. The extracted lipid or oil may comprise a mixture of lipid types and/or one or more lipid derivatives such as free fatty acids.
[43] [43] In one embodiment, the process of the second aspect of the invention results in substantial amounts of extracted lipid or oil. In one embodiment, the volume of extracted lipid or oil is at least 1 liter, preferably at least 10 liters. In a preferred embodiment, the extracted lipid or oil is packaged ready for transport and sale.
[44] [44] In one embodiment, the extracted lipid or oil comprises at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or at least 96% TAG on a weight basis. The extracted lipid or oil may comprise phospholipid, as a minor component, up to about 8% by weight, preferably less than 5% by weight, and more preferably less than 3% by weight.
[45] [45] In one embodiment, the process results in extracted lipid or oil in which one or more or all of the following characteristics apply: (i) triacylglycerols comprise at least 90%, preferably at least 95% or 96%, of the lipid or the extracted oil, (ii) the lipid or extracted oil comprises free sterols, sterol esters, sterol glycosides, waxes or wax esters, or any combination thereof, and (iii) the total sterol content and/or composition of the lipid or extracted oil is significantly different for the sterol content and/or composition of the extracted lipid or oil produced from a corresponding non-human organism or part thereof, or seeds.
[46] [46] In one embodiment, the process further comprises converting the extracted lipid or oil to an industrial product. That is, the extracted lipid or oil is converted after extracting another chemical form which is an industrial product. Preferably the product is an industrial product of hydrocarbons such as fatty acid esters, preferably fatty acid methyl esters and/or fatty acid ethyl esters, an alkane such as methane, ethane or a longer chain alkane, a mixture of alkanes longer chain, an alkene, biofuel, carbon monoxide and/or hydrogen gas, a bioalcohol such as ethanol, propanol, or butanol, biochar, or a combination of carbon monoxide, hydrogen, and biochar.
[47] [47] In the process of the first or second aspects of the invention, the vegetative plant part, or the non-human organism part may be an aerial plant part or a green plant part, such as a plant leaf or stem, a woody part such as a trunk, branch or trunk, or a root or tubercle. Often the plants are grown in a field and the parts like seeds harvested from plants in the field.
[48] [48] In one modality, the process also comprises a stage of harvesting part of the vegetative plant, non-human organism or part of it, preferably with a mechanical harvester.
[49] [49] Preferably, the vegetative parts are harvested at the time when the nonpolar lipid yields are highest. In one modality, the vegetative parts are harvested over the flowering time. In another modality, the vegetative parts are harvested from around, at the time of flowering until around the beginning of senescence. In another modality, the vegetative parts are harvested when the plants are at least about 1 month old.
[50] [50] If the organism is an algae or fungal organism, the cells can be grown in a closed container, or in an outdoor system such as a tank. The resulting organisms comprising the non-polar lipid can be harvested, for example, by a process comprising filtration, centrifugation, sedimentation, flotation or flocculation of the algae or fungal organisms, such as by adjusting the pH of the medium. Sedimentation is less preferred.
[51] [51] In the process of the second aspect of the invention, the total non-polar lipid content of the non-human organism or part thereof, a vegetative plant part or seed, is increased relative to a corresponding vegetative plant part, non-human organism or part of it, or seed.
[52] [52] In one embodiment, the part of the vegetative plant, or non-human organism or part thereof, or the seeds of the first and second aspects of the invention is further defined by three characteristics, namely Characteristic (i), Characteristic (ii) and Feature (iii), alone or in combination:
[53] [53] Characteristic (i) quantifies the extent of the increase in the level of one or more non-polar lipids or the total non-polar lipid content of the part of the vegetative plant, or non-human organism or part thereof, or of seeds that can be expressed as the degree of increase relative to weight (dry weight basis, or based on seed weight), or as the relative increase compared to the level of the corresponding vegetative plant part, or non-human organism or part thereof, or seeds. Characteristic (ii) specifies the plant genus or species, or a fungi or algal species, or other cell type, and Characteristic (iii) specifies one or more specific lipids that are increased in nonpolar lipid content.
[55] [55] Also for Characteristic (i), in a preferred modality, the total nonpolar lipid content of the vegetative plant part, or non-human organism or part thereof, or seed is increased when compared to the corresponding vegetative plant part , or non-human organism or part of it, or seed. In one embodiment, the total non-polar lipid content is increased by at least 0.5%, at least 1%, at least 2%, at least 3°: at least 4°)", at least 5%, at least 6%, at least 7%, at least 8%, at least 9th, at least 10%, at least 11%, at least 12%, at least 13%, at least 14th, at least 15% , at least 16%, at least 17'%, at least 18%, at least 19%,/at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25% or at least 26% greater in a dry weight or seed basis than the corresponding part of the vegetative plant, or non-human organism or part thereof, or seed.
[56] [56] In addition, for Trait (i), in one modality, the level of one or more non-polar lipids and/or the total non-polar lipid content is at least 1%, at least 2%, at least 3% , at least 4%, at least 5%, at least 6°0, at least 7%, at least 8%, at least 9°5, at least 10%, at least 11%, at least 12%, at least minus 13%, err minus 14%, at least 15%, at least 16%, at least 17%, at least 18°, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% greater on a relative basis than the corresponding part of the vegetative plant, or non-human organism or part thereof, or seeds.
[57] [57] Also for Characteristic (i), the extent of the increase in the level of one or more non-polar lipids and/or the total non-polar lipid content can be at least 2 times, at least 3 times, at least 4 times at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times larger, at least 10 times larger, or at least 12 times, preferably at least about 13 times, or at least less, about 15 times larger in relative terms than the corresponding vegetative part, or non-human organism or part thereof, or seeds.
[58] [58] As a result of the increase in the level of one or more non-polar lipids and/or the total non-polar lipid content, as defined in Characteristic (i), the total non-polar lipid content of the vegetative plant part, or non-human organism or part of the same, or seed is preferably between 5% and 25%, between 7° and 25%, between 10% and 25%, between 12° and 25%, between 15% and 25%, between 7% and 20% , between 10% and 20%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 20%, or about 22% each, as a percentage of dry weight or seed weight.
[59] [59] For Feature (ii), in one embodiment, the non-human organism is a plant, an alga, or an organism suitable for fermentation, such as a yeast or other fungi, preferably an oil fungus such as an oil yeast. The plant can be, or the vegetative plant part can be from, for example, a plant that is Acrocomia aculeata (Macauba palm), Arabidopsis thaliana, .Aracinis hypogaea
[60] [60] For Trait (iii), TAG, DAG, TAG and dag, MAG, total polyunsaturated fatty acid (PUFA), or a specific PUFA such as eicosadienoic acid (EDA), arachidonic acid (ARA), alpha acid -linolenic acid (ALA), stearidonic acid (SDA), eicosatrienoic acid (ETE), eicosatetraenoic acid (ETA), eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), docosahexaenoic acid (DHA), or a fatty acid comprising a group hydroxyl, an epoxy group, a cyclopropane group, a carbon-carbon double bond, a carbon-carbon triple bond, conjugated double bonds, a branched chain such as a methylated or hydroxylated branched chain, or a combination of two or more of the same, or any two, three, four, five or six of the above-mentioned groups, bonds or branched chains, is/are increased or decreased. The extent of increase in TAG, DAG, TAG and DAG, MAG, PUFA, specific PUFA, or fatty acid is as defined in Characteristic (i) above. In a preferred modality, the MAG is 2-MAG. Preferably, DAG and/or TAG, preferably the total of DAG and TAG, or MAG and TAG, are increased. In one embodiment, TAG levels are increased without increasing MAG and/or DAG content.
[61] [61] Also for Characteristic (iii), in one modality, the total fatty acid content and/or TAG content of the total comprises the non-polar lipid content (a) at least 2%, more preferably at least 5°5 more, more preferably at least 7°5 more, more preferably at least 10%
[62] [62] In preferred embodiments, one or more non-polar lipids and/or the total non-polar lipid content is defined by the combination of Characteristics (i), (ii) and (iii), or Characteristics (i) and (ii) or Characteristics (i) and (iii) or Characteristics (ii) and (iii).
[63] [63] The process of the second aspect of the invention provides, in one embodiment, that at least one or all of the following characteristics apply: (i) the level of one or more non-polar lipids in the vegetative plant part, or non-human organism or part thereof, or seed is at least 0.5% higher by weight than the level of a corresponding vegetative plant part, non-human organism or part thereof, or seed, respectively, devoid of one or plus exogenous polynucleotides, or preferably, as further defined in Feature (i), (ii) the level of one or more nonpolar lipids in the vegetative plant part, non-human organism or part thereof, or seinent is at least 1% higher on a relative basis than in a part of the corresponding vegetative plant, non-human organism or part thereof, or seeds, respectively, devoid of one or more exogenous polynucleotides, or preferentially, as further defined in Ca characteristic (i), (iii) the total nonpolar lipid content in the part of the vegetative plant, non-human organism or part thereof, or seed is at least 0.5% higher by weight than the level of a corresponding vegetative part, non-human organism or part thereof, or seed, respectively, devoid of one or more exogenous polynucleotides, or preferably, as further defined in Characteristic (i), (iv) the total nonpolar lipid content in the plant part vegetative, non-human organism or part thereof, or seed is at least 1°5 greater on a relative basis than in a part of the corresponding vegetative plant, non-human organism or part thereof, or seed, respectively, devoid of one or more exogenous polynucleotides, or preferably, as further defined in Feature (i), (v) the level of one or more non-polar lipids and/or the total non-polar lipid content of the vegetative plant part, non-human organism or part thereof, or seeds, is at least 0.5% higher on a weight basis and/or at least 1% higher on a relative basis than a corresponding vegetative plant part, non-human organism or a part thereof , or seeds, respectively, devoid of one or more exogenous polynucleotides and comprising an exogenous polynucleotide encoding a DGATI Arabidopsis thaliana or, preferably, as provided in Characteristic (i), (vi) the content of TAG, DAG, TAG and DAG, or MAG in the lipids in the part of the vegetative plant, non-human organism or part thereof, or seeds, and/or in the lipid extracted from these, is at least 10% higher in relative terms than the content of TAG, DAG, TAG and DAG, or MAG in the lipid in a corresponding part of the vegetative plant, non-human organism or part thereof, or seed, devoid of one or more exogenous polynucleotides, or a corresponding extracted lipid thereof, respectively,
[64] [64] In one embodiment, the level of a PUFA in the vegetative plant part, non-human organism or part thereof, or seeds and/or the lipid extracted from these, is increased relative to the PUFA level in a vegetative plant part corresponding, non-human organism or part thereof, or seed, or a lipid extracted therefrom, respectively, wherein the polyunsaturated fatty acid is eicosadienoic acid, arachidonic acid (ARA), alpha-linolenic acid (ALA), stearidonic acid (SDA), eicosatrienoic acid (ETE), eicosatetraenoic acid (ETA), eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), docosahexaenoic acid (DHA), or a combination of two or more of the same. Preferably, the extent of the increase is as defined in Feature (i).
[65] [65] In an embodiment of the second aspect, the corresponding vegetative plant part, or non-human organism or part thereof, or seed is a non-transgenic part of the vegetative plant, or non-human organism or part thereof, or seed, respectively. . In a preferred embodiment, the corresponding part of the vegetative plant, or non-human organism or part thereof, or seed is of the same cultivar, strain or variety, but lacking one or more exogenous polynucleotides. In another preferred modality, the corresponding part of the vegetative plant, or non-human organism or part thereof, or seeds is at the same stage of development, for example, flowering, as part of the vegetative plant, or non-human organism or part of the same, or seed. In another modality, the vegetative parts are harvested from around, at the beginning of flowering until around the beginning of senescence.
[66] [66] In one embodiment, a part of the non-human organism is the seed and the total oil content, or total fatty acid content, of the seed is at least 0.5% to 25%, or at least , 1.0% to 24%, greater on a weight basis than a corresponding seed devoid of one or more exogenous polynucleotides.
[67] [67] In one embodiment, the relative DAG content of seed oil is at least 10%, at least 10.5%, at least 11%, at least 11.5%, at least 12%, at least 12, 5%, at least 13%, at least 13.5%, at least 14%, at least 14.5%, at least 15%, at least 15.5%, at least 16%, at least 16.5% , at least 17%, at least 17.5%, at least 18%, at least 18.5%, at least 19%, at least 19.5%, at least 20% higher on a relative basis than oil of a corresponding seed. In one embodiment, the DAG content of the seed is increased by an amount as defined in Feature (i) and the seed is of a genus and/or species as defined in Feature (ii).
[68] [68] In one modality, the relative TAG content of the seed is at least 5%, at least 5.5%, at least 6%, at least 6.5%, at least 7°5, at least 7 .5°s, at least 8°5, at least 8.1%, at least 9%, at least 9.5%, at least 10%, or at least 11% greater in absolute terms relative to a seed corresponding. In one embodiment, the TAG content of the seed is increased by an amount as defined in Trait (i) and the seed is of a genus and/or species as defined in Trait (ii).
[69] [69] In another embodiment, the non-human organism part is a vegetative plant part and the TAG, DAG, TAG and DAG, or MAG content of the vegetative plant part is at least 10%, at least 11%, at least at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least at least 22, at least 23%, at least 24%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% greater on a relative basis than the TAG, DAG, TAG and DAG, or MAG content of a corresponding vegetative plant part lacking one or more exogenous polynucleotides. In a preferred modality, the MAG is 2-MAG. In one embodiment, the content of TAG, DAG, TAG and DAG, or MAG of the vegetative plant part is determined from the amount of these lipid components in the extractable lipid of the vegetative plant part. In another embodiment, the TAG, DAG, TAG and DAG, or MAG content of the transgenic vegetative plant part is increased by an amount as defined in Feature (i).
[70] [70] In one modality at least 20% (mol%), at least 22% (mol%), at least 30% (mol%), at least 40% (mol%), at least 50°õ (% mol) or at least 60°ó (°; mol), preferably at least 65% (°5 mol), more preferably at least 66% (% mol), at least 67 % (mol%), at least 68% (mol%), of at least 69% (mol%) or at least 70% (mol%) of the fatty acid content of the total nonpolar lipid content of the part of the vegetative plant, non-human organism or part thereof, or seed, or the lipid or oil extracted from them, preferably from the TAG fraction, is oleic acid. These high oleic acid contents are preferred for use in biodiesel applications.
[71] [71] In another embodiment, the PUFA content of the vegetative plant part, or non-human organism or part thereof, or seed is increased (eg in the presence of an MGAT) or decreased (eg in the absence of a MGAT) when compared to the corresponding part of the vegetative plant, or non-human organism or part thereof, or seeds. In this context, PUFA content includes both esterified PUFA (including TAG, DAG, etc.) and non-esterified PUFA. In one embodiment, the PUFA content of the vegetative plant part, or non-human organism or part thereof, or the seeds are preferably determined from the amount of PUFA in the extractable lipid of the vegetative plant part, or non-human organism or part thereof. of the same or seed. The extent of the PUFA content increase can be as defined in Feature (i). The PUFA content can comprise EDA, ARA, ALA, SDA, ETE, ETA, EPA, DPA, DHA, or a combination of two of more of these.
[72] [72] In another embodiment, the level of a PUFA in the vegetative plant part, non-human organism or part thereof, or seed, or the lipid or oil extracted therefrom is increased or decreased compared to the vegetative plant part corresponding, non-human organism or part thereof, or seed, or lipid or oil extracted therefrom. The PUFA can be EDA, ARA, ALA, SDA, ETE, ETA, EPA, DPA, DHA, or a combination of two of more of these. The extent of PUFA increase can be as defined in Characteristic (i).
[73] [73] In another embodiment, the level of a fatty acid in the extracted lipid or oil is increased when compared to the lipid extracted from the corresponding vegetative plant part, or non-human organism or part thereof, or from seinants and in which the fatty acid comprises a hydroxyl group, an epoxy group, a cyclopropane group, a carbon-carbon double bond, a carbon-carbon triple bond, conjugated double bonds, a branched chain such as a methylated or hydroxylated branched chain, or a combination of two or more thereof, or any of two, three, four, five or six of the aforementioned groups, bonds or branched chains. The extent of fatty acid increase can be as defined in Characteristic (i).
[74] [74] In one embodiment, the level of one or more nonpolar lipids (such as TAG, DAG, TAG and DAG, MAG, PUFA, or a specific PUFA, or a specific fatty acid) and/or the total nonpolar lipid content is determinable by means of gas chromatography analysis of fatty acid methyl esters obtained from the extracted lipid. Alternative methods for determining any of these contents are known in the art, and include methods that do not require extracting lipids from the organism or part thereof, for example, by near infrared (NIR) or by nuclear magnetic resonance (NMR) analysis ).
[75] [75] In another embodiment, the level of one or more nonpolar lipids and/or the total nonpolar lipid content of the vegetative plant part, or non-human organism or part thereof, or seed is at least 0.5° õ higher on a dry weight basis, or on the seed weight and/or at least 1°5 higher in relative terms, preferably at least 1°5 or 2"0 higher on a dry weight basis or on the weight of the seed. seed, of a corresponding vegetative plant part, or non-human organism or a part thereof, or seed lacking one or more exogenous polynucleotides but comprising an exogenous polynucleotide encoding an Arabidopsis thaliana DGATI (SEQ ID NO: 83).
[76] [76] In yet another embodiment, the part of the vegetative plant or the non-human organism or part thereof, or seeds that further comprises (i) one or more introduced mutations, and/or (ii) an exogenous polynucleotide that negatively regulates production and/or activity of an endogenous enzyme from the vegetative plant part or the non-human organism or part thereof, the endogenous enzyme being selected from a fatty acid acyltransferase such as DGAT, snl glycerol-3-phosphate acyltransferase (sn- l GPAT), 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT), acyl-CoA: lysophosphatidylcholine acyltransferase (LPCAT), phosphatidic acid phosphatase (PAP), an enzyme involved in starch biosynthesis such as (PzDP)-glucose pyrophosphorylase (AGPase), a fatty acid desaturase such as a LJ12 fatty acid desaturase (FAD2), a polypeptide involved in lipid degradation and/or lipid lowering as a lipase such as CGi58 polypeptide or triacylglycerol lipase dependent of sugar, or a combination of two or more of these. In an alternative embodiment, the part of the vegetative plant or the non-human organism or part thereof does not comprise (i) above, or does not comprise (ii) above, or does not comprise (i) above and does not comprise (ii) above. In one embodiment, the exogenous polynucleotide that down-regulates AGPase production is not the polynucleotide described in Sanjaya et al. (2011). In one embodiment, the exogenous polynucleotides in the part of the vegetative plant or non-human organism or part thereof or seed do not consist of an exogenous polynucleotide encoding a WRII and an exogenous polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding an AGPase.
[77] [77] In the process of the first or second aspects, the part of the vegetative plant, or non-human organism or part thereof, or seed, or the lipid or oil extracted, is further defined in the preferred modalities. Therefore, in one embodiment one or more or all of the following characteristics apply: (i) oleic acid comprises at least 20% (% mol), at least 22% (°5 mol), at least 30% { °5 mol), at least 40% (°5 mol), at least 50% (°0 mol), or at least 60% (°5 mol), preferably at least 65°: (° 0 mol) or at least 66% (mol%) of the total content of fatty acids in the non-polar lipid or oil in the vegetative plant part, non-human organism or part thereof, or components, (ii) oleic acid comprises at least at least 20% (% mol), at least 22°ó (°5 mol), at least 30% (°5 mol), at least 40°õ (°5 mol), at least 50% ( °5 mol), or at least 60°õ (°5 mol), preferably at least 65% (°5 mol) or at least 66% (mol%) of the total fatty acid content in the lipid or extracted oil, (iii) the non-polar lipid or oil in the part of the vegetative plant, non-human organism or part thereof, or seed comprises a fatty acid comprising a hydroxyl group, a gr epoxy, a cyclopropane group, a carbon-double bond
[78] [78] In one embodiment, the level of a lipid in the vegetative plant part, non-human organism or part thereof, or in seeds and/or in the lipid or extracted oil is determinable by means of gas chromatography analysis of methyl esters of fatty acids prepared from the extracted lipid or oil. The method of analysis is preferably as described in Example 1 herein.
[79] [79] Again with regard to the first or second aspects, the invention provides one or more exogenous polynucleotides in the vegetative plant part, or non-human organism or part thereof, or seeds used in the process. Therefore, in one embodiment, the part of the vegetative plant, or the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide that encodes an RNA or, preferably, a polypeptide transcription factor that increases the expression of an or more genes for fatty or glycolytic acid biosynthesis in a part of the vegetative plant, or a non-human organism or a part thereof, or a seed, respectively, and a second exogenous polynucleotide encoding an RNA or a polypeptide involved in the biosynthesis of one or more nonpolar lipids, in which the first and second exogenous polynucleotides are each operably linked to a promoter that is capable of directing the expression of the polynucleotide in a part of the vegetative plant, or a non-human organism or a part thereof, or a seed, respectively. That is, the first and second exogenous polynucleotides encode different factors that together provide the increase in the nonpolar lipid content in the vegetative plant part, or the non-human organism or part of it, or the seed.
[80] [80] The augmentation is preferably additive, more preferably synergistic, relative to the presence of the first or second exogenous polynucleotide alone. The factors encoded by the first and second polynucleotides operate by different mechanisms. Preferably, the polypeptide transcription factor increases the availability of substrates for the synthesis of nonpolar lipids, such as, for example, by increasing glycerol-3-phosphate and/or fatty acids, preferably in the form of acyl-CoA, through increased gene expression, for example, at least 5 or at least 8 genes involved in fatty acid biosynthesis or glycolysis (such as, among others, one or more of the ACCase, sucrose transporters (SuSy, cell wall invertases) , ketoacyl synthase (KAS), phosphofructokinase (PFK), pyruvate kinase (PK) (eg (At5g52920, At3g22960), pyruvate dehydrogenase, hexose transporters (eg GPT2 and PPTl), cytosolic fructokinase, cytosolic, phosphoglycerate enoyl-ACP reductase (At2g05990), and phosphoglycerate mutase (At1g22170), preferably more than one gene for each category. In one embodiment, the first exogenous polynucleotide encodes a
[81] [81] In a preferred embodiment, the part of the vegetative plant, or non-human organism or a part thereof, or the seed, of the first and second aspects of the invention comprises two or more exogenous polynucleotides, one of which encodes a transcription factor a polypeptide that increases the expression of one or more fatty acid or glycolytic biosynthesis genes in the part of the vegetative plant, or non-human organism or a part thereof, or seeds, such as a Wrinkled transcription factor 1 (WRII), and a second of which encode a polypeptide involved in the biosynthesis of one or more nonpolar lipids, such as a DGAT.
[82] [82] In one embodiment, the vegetative plant part, non-human organism or part thereof, or the seed of the first or second aspects of the invention may further comprise a third or more exogenous polynucleotides. The third or more exogenous polynucleotides may encode one or more, or any combination of: i) another RNA or polypeptide transcription factor that enhances the expression of one or more fatty acid or glycolytic biosynthesis genes in a non-human organism or a part thereof (for example, if the first exogenous polynucleotide encodes a wrinkled transcription factor 1 (WRII), the third exogenous polynucleotide may encode a transcription factor of LEC2 or BBM (preferably, expression of LEC2 or BBM controlled by a inducible promoter or a promoter that does not result in high transgene expression levels), ii) another RNA or polypeptide involved in the biosynthesis of one or more nonpolar lipids (eg, if the second exogenous polynucleotide encodes a DGAT, the third exogenous polynucleotide may encode an MGAT or GPAT, or two other exogenous polynucleotides may be present which encode an MGAT and a GPAT), iii) a polypeptide which is stabilizes one or more nonpolar lipids, preferably an oleosin, such as a polyoleosin or a kaleosin, more preferably a polyoleosin, iv) an RNA molecule that inhibits the expression of a gene encoding a polypeptide involved in starch biosynthesis, such as a AGPase polypeptide, v) an RNA molecule that inhibits the expression of a gene that encodes a polypeptide involved in lipid degradation and/or that reduces lipid content, such as a lipase, such as CGi58 polypeptide or sugar-dependent triacylglycerol lipase 1, or vi) a silencing suppressor polypeptide, wherein the third one or more exogenous polynucleotides is operably linked to a promoter that is capable of directing the expression of the polynucleotides in a part of the vegetative plant, or a non-human organism or a part thereof , or a seed, respectively.
[83] [83] A number of specific combinations of genes are shown here to be effective in increasing nonpolar lipid content. Therefore, in relation to the process of the first or second aspects of the invention, in one embodiment, the part of the vegetative plant, or the non-human organism or part thereof, or the seed comprises one or more exogenous polynucleotides encoding: i) a a wrinkled transcription factor 1 (WRII) and a DGAT, ii) a transcription factor WRII and a DGAT and an oleosin, iii) a transcription factor WRII, a DGAT, a MGAT and an oleosin, iv) a monoacylglycerol acyltransferase (MGAT ), v) a diacylglycerol acyltransferase 2 (DGAT2), vi) a MGAT and a glycerol-3-phosphate acyltransferase (GPAT), vii) a MGAT and a DGAT, viii) a MGAT, a GPAT and a DGAT, ix) one transcription factor WRII and one MGAT, x) one transcription factor WRII, one DGAT and one MGAT, xi) one transcription factor WRII, one DGAT, one MGAT, one oleosin and GPAT, xii) one DGAT and one oleosin, or xiii) an MGAT and an oleosin, and xiv) optionally, a silencing suppressor polypeptide,
[84] [84] In one embodiment, (i) GPAT also has phosphatase activity to produce MAG, as a polypeptide having an amino acid sequence of GPAT4 or GPAT6 Arabidopsis, and/or (ii) DGAT is either a DGATI or a DGAT2, and /or (iii) the MGAT is an MGATI or an MGAT2.
[85] [85] In a preferred embodiment, the vegetative plant part, non-human organism or part thereof, or seed comprises a first exogenous polynucleotide encoding a WRII and a second exogenous polynucleotide encoding a DGAT, preferably a DGATI.
[86] [86] In another preferred embodiment, the vegetative plant part, non-human organism or part thereof, or seed comprises a first exogenous polynucleotide encoding a WRII and a second exogenous polynucleotide encoding a DGAT, preferably a DGATI and a third exogenous polynucleotide that encodes an oleosin.
[87] [87] In another embodiment, the vegetative plant part, non-human organism or part thereof, or seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, and a fourth exogenous polynucleotide encoding an MGAT, preferably an MGAT2.
[88] [88] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, and a fourth exogenous polynucleotide encoding LEC2 or BBM.
[89] [89] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, a fourth exogenous polynucleotide encoding an MGAT, preferably an MGAT2, and a fifth exogenous polynucleotide encoding LEC2 or BBM.
[90] [90] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the sernant comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, and a fourth exogenous polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding a lipase such as CGi58 polypeptide.
[91] [91] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, fourth exogenous polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding a lipase, such as a CGi58 polypeptide, and a fifth exogenous polynucleotide encoding LEC2 or BBM.
[92] [92] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, fourth exogenous polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding a lipase such as a CGi58 polypeptide, and a fifth exogenous polynucleotide encoding an MGAT, preferably an MGAT2.
[93] [93] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGAT 1, a third exogenous polynucleotide encoding an oleosin, a fourth exogenous polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding a lipase, such as a CGi58 polypeptide, a fifth exogenous polynucleotide encoding an MGAT, preferably an MGAT2, and a sixth exogenous polynucleotide encoding LEC2 or BBM.
[94] [94] In one embodiment, the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, and a fourth exogenous polynucleotide encoding an MGAT , preferably an MGAT2. Preferably, the senent further comprises a fifth exogenous polynucleotide encoding a GPAT.
[95] [95] Where relevant, instead of a polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding a lipase, such as a CGi58 polypeptide, the vegetative plant part, the non-human organism or part thereof, or the seed has one or more mutations introduced into the lipase gene, such as a CGi58 gene that confers reduced levels of the lipase polypeptide, when compared to a corresponding vegetative plant part, non-human organism or part thereof, or seeds devoid of mutation.
[96] [96] In a preferred embodiment, exogenous polynucleotides encoding DGAT and oleosin are operably linked to a constitutive promoter, or a promoter active in green plant tissues, at least before and until flowering, which is capable of direct the expression of polynucleotides in the vegetative plant part, the non-human organism or part thereof, or the seed. In another preferred embodiment, the exogenous polynucleotide encoding WRII, and the RNA molecule that inhibits the expression of a gene encoding a lipase, such as a CGi58 polypeptide, is operably linked to a constitutive promoter, a promoter active in green tissues of a plant, at least before and until flowering, or an inducible promoter, which is capable of directing the expression of the polynucleotides in the vegetative plant part, the non-human organism or part thereof, or the seed. In yet another preferred embodiment, the exogenous polynucleotides encoding LEC2, BBM and/or MGAT2 are operably linked to an inducible promoter, which is capable of directing the expression of the polynucleotides in the vegetative plant part, the non-human organism or part thereof, or the seed.
[97] [97] In each of the above embodiments, polynucleotides can be provided as separate molecules or they can be provided as a single contiguous molecule, such as in a single T-DNA molecule. In one embodiment, the transcriptional orientation of at least one gene in the T-DNA molecule is opposite to the transcriptional orientation of at least one other gene in the T-DNA molecule.
[98] [98] In each of the above modalities, the total nonpolar lipid content of the vegetative plant part, or non-human organism or part thereof, or the seed, preferably a plant leaf or part thereof, stem or tuber, is at least about 3%, more preferably at least about 5%, preferably at least about 7%, more preferably at least about 10%, more preferably at least about 11%, most preferably at least about 12%, more preferably at least about 13°s, more preferably at least about 14%, or more preferably at least about 15% (w/w dry weight). In another preferred modality, the total nonpolar lipid content is between 5% and 25%, between 7% and 25%, between 10% and 25%, between 12% and 25%, between 15% and 25%, between 7% and 20%, between 10% and
[99] [99] Furthermore, in each of the above modalities, the total TAG content of the vegetative plant part, or non-human organism or part thereof, or the seed, preferably a plant leaf or part thereof, stem or tuber , is at least about 3%, more preferably at least about 5°5, preferably at least about 7%, more preferably at least about 10%, more preferably at least about 11%, most preferably at least about 11%. less about 12%, more preferably at least about 13%, more preferably at least about 14%, more preferably at least about 15%, or more preferably at least about 17% (w/w dry weight) . In another preferred modality, the total TAG content is between 5% and 30%, between 7% and 30%, between 10% and 30%, between 12% and 30%, between 15% and 30%, between 7% and 30%, between 10% and 30%, between 20% and 28%, between 18% and 25%, between 22% and 30%, about 10%, about 11%, about 12%, about 13% , about 14%, about 15%, about 16%, about 17%, about 18%, about 20%, or about 22%, each as a percentage of dry weight or seed weight. In a particularly preferred embodiment, the vegetative plant part is a leaf (or leaves) or a portion thereof. In a more preferred embodiment, the vegetative plant part is a leaf portion having a surface area of at least 1 cm 2 .
[103] [103] Preferably, the characteristics defined for the two modalities above are as in the flowering stage of the plant.
[104] [104]In an alternative embodiment, the vegetative plant part, the non-human organism or part thereof, or where the seed consists of one or more exogenous polynucleotides encoding a DGATI and an LEC2.
[105] [105] In a preferred embodiment, the exogenous polynucleotide encoding WRII comprises one or more of the following characteristics: i) nucleotides whose sequence is presented as any one of SEQ ID NOS: 231 to 278, ii) nucleotides encoding a polypeptide which comprises amino acids whose sequence is presented as any one of SEQ ID NOs: 279 to 337, or a biologically active fragment thereof, iii) nucleotides whose sequence of is at least 30% identical to i) or ii), and iv) nucleotides that hybridize to any one of i) to iii) under stringent conditions.
[106] [106] In a preferred embodiment, the exogenous polynucleotide encoding DGAT comprises one or more of the following characteristics: i) nucleotides, whose sequence is presented as any one of SEQ ID NOS: 204 to 211, 338 to 346, ii) nucleotides which encode a polypeptide comprising the amino acids whose sequence is presented as any one of SEQ ID NOS: 83, 212 to 219, 347 to 355, or a biologically active fragment thereof, iii) nucleotides whose sequence of is at least 30% identical to i) or ii), and iv) a polynucleotide that hybridizes to any one of i) to iii) under stringent conditions.
[107] [107] In another preferred embodiment, the exogenous polynucleotide encoding MGAT comprises one or more of the following: i) nucleotides, the sequence of which is presented as any one of SEQ ID NOS: 1 to 44, ii) nucleotides encoding a polypeptide comprising amino acids whose sequence is presented as any one of SEQ ID NOS: 45 to 82, or a biologically active fragment thereof, iii) nucleotides whose sequence of is at least 30% identical to i) or ii), and iv) a polynucleotide which hybridizes to any one of i) to iii) under stringent conditions.
[108] [108] In another preferred embodiment, the exogenous polynucleotide encoding GPAT comprises one or more of the following: i) nucleotides whose sequence is shown as any one of SEQ ID NOs: 84 to 143, ii) nucleotides encoding a polypeptide which comprises amino acids whose sequence is presented as any one of SEQ ID NOs: 144 to 203, or a biologically active fragment thereof, iii) nucleotides whose sequence is at least 30% identical to i) or ii), and iv) a polynucleotide that hybridizes to any one of i) to iii) under stringent conditions.
[109] [109] In another preferred embodiment, the exogenous polynucleotide encoding DGAT2 comprises one or more of the following characteristics: i) nucleotides whose sequence is presented as any one of SEQ ID NOS: 204 to 211, ii) nucleotides encoding a polypeptide which comprises amino acids whose sequence is presented as any one of SEQ ID NOS: 212 to 219, or a biologically active fragment thereof, iii) nucleotides whose sequence of is at least 30% identical to i) or ii), and iv) a polynucleotide that hybridizes to any one of i) to iii) under stringent conditions.
[111] [111] In one embodiment, the CGi58 polypeptide comprises one or more of the following: i) nucleotides, the sequence of which is presented as any one of SEQ ID NOs: 422 to 428, ii) nucleotides that encode a polypeptide comprising the amino acids whose sequence is presented as any one of SEQ ID NOS: 429 to 436, or a biologically active fragment thereof, iii) nucleotides whose sequence of is at least 30% identical to i) or ii), and iv) a nucleotide sequence that hybridizes with any one of i) to iii) under strict conditions.
[112] [112] In another embodiment, the exogenous polynucleotide encoding LEC2 comprises one or more of the following characteristics: i) nucleotides, the sequence of which is presented as any one of SEQ ID NOS: 437 to 439, ii) nucleotides encoding a polypeptide comprising amino acids whose sequence is presented as any one of SEQ ID NOS: 442 to 444, or a biologically active fragment thereof, iii) nucleotides whose sequence is at least 30° identical to i) or ii), and iv) a nucleotide sequence that hybridizes to any one of i) to iii) under stringent conditions.
[113] [113] In another embodiment, the exogenous polynucleotide encoding BBM comprises one or more of the following: i) nucleotides, the sequence of which is presented as any one of SEQ ID NOS: 440 or 441, ii) nucleotides encoding a polypeptide comprising amino acids whose sequence is presented as any one of SEQ ID NOS: 445 or 446, or a biologically active fragment thereof, iii) nucleotides whose sequence of is at least 30% identical to i) or ii), and iv) a sequence of nucleotides that hybridizes to any one of i) to iii) under stringent conditions.
[114] [114] Clearly, preferred sequences from one embodiment can be combined with preferred sequences from another embodiment, and even more advantageously combined with a preferred sequence from yet another embodiment.
[115] [115] In one embodiment, the one or more exogenous polynucleotides that encode a mutant MGAT and/or DGAT and/or GPAT. For example, one or more exogenous polynucleotides can encode an MGAT and/or DGAT and/or GPAT having one, or more than one, conserved amino acid substitutions, as exemplified in Table 1 with respect to an MGAT and/or DGAT and/or wild-type GPAT as defined by a SEQ ID NO herein.
[116] [116] In one embodiment, the vegetative plant part, non-human organism or part thereof, or seed comprises a first exogenous polynucleotide encoding a MGAT and a second exogenous polynucleotide encoding a DGAT. The first and second polynucleotides can be provided as separate molecules, or they can be provided as a single contiguous molecule, such as in a single DNA single T-molecule.
[117] [117]The vegetative plant part, non-human organism or part thereof, or the seeds may comprise a third exogenous polynucleotide encoding, for example, a DGAT. The first, second, and third polynucleotides can be provided as separate molecules or they can be provided as a single contiguous molecule, such as in a single T-DNA molecule. DGAT acts to catalyze the formation of TAG in the transgenic vegetative plant part, non-human organism or part thereof, or seeds by acylating the DAG (preferably produced via the MGAT pathway) with an acyl group derived from fatty acyl-CoA. In one embodiment, the transcriptional orientation of at least one gene in the T-DNA molecule is opposite to the transcriptional orientation of at least one other gene in the T-DNA molecule.
[118] [118] In another embodiment, the part of the vegetative plant, non-human organism or part thereof, or seed comprises a first exogenous polynucleotide encoding a MGAT and a second exogenous polynucleotide encoding a DGAT. The first and second polynucleotides can be provided as separate molecules or they can be provided as a single contiguous molecule, such as in a single DNA single T-molecule.
[119] [119] Furthermore, an endogenous gene activity in the plant, part of the vegetative plant, or the non-human organism or part thereof, or the seed may be down-regulated. Therefore, in one embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises one or more of the following: (i) one or more mutations introduced into a gene encoding an endogenous plant enzyme, vegetative plant part, non-human organism or part thereof, or seed, respectively, or (ii) an exogenous polynucleotide that down-regulates the production and/or activity of an endogenous plant enzyme, vegetative plant part, non-organism human or part thereof, or seed, respectively, in which each endogenous enzyme is selected from the group consisting of a fatty acid acyltransferase such as DGAT, a sn-l glycerol-3-phosphate acyltransferase (sn-l GPAT), a 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT), an acyl-CoA: lysophosphatidylcholine acyltransferase (LPCAT), a phosphatidic acid phosphatase (PAP), an enzyme involved in starch biosynthesis such as (ADP) pyrophosphorylase- glucose (AGPase), a desaturase of fatty acid, such as an A12 fatty acid desaturase (FAD2 ), a polypeptide involved in lipid degradation and/or that lowers lipid content, such as a lipase, such as a CGi58 polypeptide or sugar-dependent triacylglycerol lipase, or a combination of two or more of them. In one embodiment, the exogenous polynucleotide is selected from the group consisting of an antisense polynucleotide, a sense polynucleotide, a catalytic polynucleotide, a microRNA, a polynucleotide encoding a polypeptide that binds to the endogenous enzyme, a chain RNA molecule RNA molecule or a processed RNA molecule derived from them. In one embodiment, the exogenous polynucleotide that down-regulates AGPase production is not the polynucleotide described in Sanjaya et al. (2011). In one embodiment, the exogenous polynucleotides within the part of the vegetative plant or non-human organism or part thereof or seed do not consist of an exogenous polynucleotide encoding a WRII and an exogenous polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding an AGPase.
[120] [120] Increasing the level of nonpolar lipids is important for applications involving particular fatty acids. Therefore, in one embodiment, the total non-polar lipid, lipid or extracted oil comprises: (i) non-polar lipid which is TAG, DAG, TAG and DAG, or MAG, and (ii) a specific PUFA which is EDA, ARA , SDA, ETE, ETA, EPA, DPA, the DHA, the specific PUFA being at a level of at least 1% of the total fatty acid content in the non-polar lipid, or a combination of two or more of the specific PUFAs, or (iii ) a fatty acid, which is present at a level of at least 1% of the total fatty acid content in the non-polar lipid and which comprises a hydroxyl group, an epoxy group, a cyclopropane group, a carbon-carbon double bond, a bond carbon-carbon triplet, conjugated double bonds, a branched chain such as a methylated or hydroxylated branched chain, or a combination of two or more thereof, or any two, three, four, five or six of the aforementioned groups, bonds or branched chains.
[121] [121] In a third aspect, the invention provides non-human organisms, preferably plants, or parts, such as vegetative or seed parts, which are useful in processes of the first and second aspects or in other aspects described below. Each of the features of the embodiments described for the first and second aspects can be applied mutatis mutandis to non-human organisms, preferably plants, or parts thereof, such as parts of plants or vegetative seeds of the third aspect. Particular modalities are indicated as follows.
[122] [122] In an embodiment of the third aspect, the invention provides a plant comprising a vegetative part, or the vegetative part thereof, wherein the vegetative part has a total nonpolar lipid content of at least about 3%, more preferably at least at least about 5%, preferably at least about 7.5, more preferably at least about 10%, more preferably at least about 11%, more preferably at least about 12%, most preferably at least about 13% , more preferably at least about 14%, or more preferably at least about 15% (w/w dry weight). In another preferred modality, the total non-polar lipid content is between 5% and 25%, between 7% and 25%, between 10% and 25%, between 12% and 25%, between 15% and 25%, between 7 % and 20%, between 10% and 20%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17 %, about 18%, about 20%, or about 22%, each as a percentage of dry weight. In a particularly preferred embodiment, the vegetative plant part is a leaf (or leaves) or a portion thereof. In a more preferred embodiment, the vegetative plant part is a leaf portion having a surface area of at least 1 cm2. In another embodiment, the non-polar lipid comprises at least 90% triacylglycerols (TAG). Preferably, the plant is fertile, morphologically normal, and/or agronomically useful. Seed of the plant preferably germinates at a rate substantially equal to a corresponding wild-type plant. Preferably, the vegetative part is a leaf or a stem, or a combination of the two, or a root or tuber such as, for example, potato tubers.
[123] [123] In another embodiment, the non-human organism, preferably plants, or part thereof, as part of the vegetative plant or seed comprises one or more exogenous polynucleotides as defined herein, and has an increased level of one or more nonpolar lipids and /or the total nonpolar lipid content which is at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, or at least 12 times, preferably at least about 13 times, or at least about 15 times larger in relative terms than a corresponding non-human organism, preferably plant, or part thereof, such as part of the vegetative plant or seed devoid of one or more exogenous polynucleotides.
[124] [124] In one embodiment, the invention provides a canola plant comprising canola seed whose oil content is at least 45% on a weight basis. Preferably, the canola plant or its seed has characteristics as described in the first and second aspects of the invention.
[125] [125] In one embodiment, the invention provides a corn plant comprising corn seed, whose oil content is at least 5% on a weight basis. Preferably, the corn plant or its seed has characteristics as described in the first and second aspects of the invention.
[126] [126] In one embodiment, the invention provides a soybean plant comprising soybean seed whose oil content is at least 20% on a weight basis. Preferably, the soybean plant or its seed has characteristics as described in the first and second aspects of the invention.
[127] [127] In one embodiment, the invention provides a lupine plant comprising lupine seed whose oil content is at least 10% on a weight basis. Preferably, the lupine plant or its seed has characteristics as described in the first and second aspects of the invention.
[128] [128] In one embodiment, the invention provides a peanut plant comprising peanuts whose oil content is at least 50% on a weight basis. Preferably, the peanut plant or its seed has characteristics as described in the first and second aspects of the invention.
[129] [129] In one embodiment, the invention provides a sunflower plant comprising sunflower seed whose Oil content is at least 50% on a weight basis. Preferably, the sunflower plant or its seed has characteristics as described in the first and second aspects of the invention.
[130] [130] In one embodiment, the invention provides a cotton plant comprising cottonseed whose oil content is at least 41% on a weight basis. Preferably, the cotton plant or its seed has characteristics as described in the first and second aspects of the invention.
[131] [131] In one embodiment, the invention provides a safflower plant comprising safflower seed whose oil content is at least 35% on a weight basis. Preferably, the safflower plant or its series has characteristics as described in the first and second aspects of the invention.
[132] [132] In one embodiment, the invention provides a flaxseed plant comprising flaxseed whose oil content is at least 36% on a weight basis. Preferably, the flaxseed plant or its seed has characteristics as described in the first and second aspects of the invention.
[133] [133] In one embodiment, the invention provides a Camelina sativa plant comprising Camelina sativa seed whose oil content is at least 36% on a weight basis. Preferably, the Camelina sativa plant or its seed has characteristics as described in the first and second aspects of the invention.
[134] [134]In embodiments, plants can be further defined by features (i), (ii) and (iii) as described here earlier. In a preferred embodiment, the plant or vegetative part comprises one or more or all of the following characteristics: (i) oleic acid in a vegetative part or seed of the plant, the oleic acid being in an esterified or non-esterified form, wherein, at least 20% (mol%), at least 22% (mol%), at least 30% (mol%), at least 40% (mol%), at least 50% (°5mol), or at least 60% (°0 mcl), preferably at least 65% (mol %) or at least 66% (mol %) of the total fatty acids in the lipid content of the vegetative part or seed is the oleic acid, (ii) oleic acid in a vegetative part or the seed of the plant, oleic acid, being in an esterified form in nonpolar lipids, in which at least 20% (mol%), at least 22% (°5 mol), at least 30% (mol%), at least 40% (mol%), at least 50% (°5 mol), or at least 60% (°5 mol), preferably at least , 65% ("5 mol) or at least 66% (mol%) of the total fatty acids in the lipid content nonpolar part of the vegetative part or seed is oleic acid, (iii) a fatty acid modified from a vegetative part or the seed of the plant, the modified fatty acid being in an esterified or non-esterified form, preferably in an esterified form in non-polar lipids of the vegetative or seed part, in which the modified fatty acid comprises a hydroxyl group, an epoxy group, a cyclopropane group, a carbon-carbon double bond, a carbon-carbon triple bond, conjugated double bonds, a branched chain, or a chain methylated or hydroxylated branched, or a combination of two or more thereof, or any of two, three, four, five or six of the aforementioned groups, branched chains or bonds, and (iv) waxes and/or wax esters in non-polar lipid from the vegetative part or the seed of the plant.
[135] [135]In one embodiment, the plant or vegetative plant part is a member of a population or collection of at least about 1000 such plants or parts. That is, each plant or plant part in the population or collection has essentially the same properties or comprises the same exogenous nucleic acids as the other members of the population or collection. Preferably, the plants are homozygous for the exogenous polynucleotides, which provides a degree of uniformity. Preferably the plants are growing in a field. The collection of vegetative plant parts were harvested preferentially from plants growing in a field. Preferably, the vegetative plant parts were harvested at the time when the nonpolar lipid yields are the highest. In one modality, the vegetative plant parts were harvested over the flowering time. In another modality, the vegetative parts are harvested when the plants are at least about 1 month old. In another modality, the vegetative parts are harvested from around, at the time of flowering until around the beginning of senescence. In another embodiment, vegetative plant parts are harvested at least about 1 month after induction of inducible gene expression.
[136] [136] In another embodiment of the third aspect, the invention provides a vegetative plant part, non-human organism or a part thereof, or seeds, comprising one or more exogenous polynucleotides and an increase in the level of one or more nonpolar lipids in relation to a corresponding vegetative plant part, non-human organism or a part thereof, or seed lacking one or more exogenous polynucleotides, each of the one or more exogenous polynucleotides being operably linked to a promoter that is capable of directing expression of the polynucleotide in a part of the vegetative plant,
[138] [138] In a modality of (ii) above, the total non-polar lipid content is between 5% and 25%, between 7% and 25%, between 10% and 25%, between 12% and 25%, between 15% and 25%, between 7% and 20%, between 10% and 20%, about 10%, about 11%, about 12%, about 13%, about 14°, about 15%, about of 16%, about 17%, about 18%, about 20%, or about 22% each, as a percentage of dry weight. In a more preferred embodiment, the vegetative plant part is a leaf portion having a surface area of at least 1 cm2.
[139] [139] In preferred embodiments, the non-human organism or part thereof is a plant, an alga, or an organism suitable for fermentation, such as a fungus. The non-human part of the organism can be a seed, fruit, or a vegetative part of a plant, such as an aerial plant part or a green part COIllO a leaf or stem. In another embodiment, the part is a cell of a multicellular organism. As far as the non-human organism part is concerned, the part comprises at least one cell of the non-human organism. In other preferred embodiments, the non-human organism or part thereof is further defined by features as defined in any of the embodiments described in the first and second aspects of the invention, including, but not limited to, features (i), (ii) and (iii ), and exogenous polynucleotides or combinations of exogenous polynucleotides, as defined in any of the embodiments described in the first and second aspects of the invention.
[140] [140] In one embodiment, the plant, vegetative plant part, non-human organism or part thereof, or seed comprises one or more exogenous polynucleotides encoding: i) a wrinkled transcription factor 1 (WRII) and a DGAT , ii) a transcription factor WRII and a DGAT and an oleosin, iii) a transcription factor WRII, a DGAT, a MGAT and an oleosin, iv) a monoacylglycerol acyltransferase (MGAT), v) a diacylglycerol acyltransferase 2 (DGAT2) , vi) one MGAT and one glycerol-3-phosphate acyltransferase (GPAT), vii) one MGAT and one DGAT, viii) one MGAT, one GPAT and one DGAT, ix) one transcription factor WRII and one MGAT, X) one transcription factor WRII, one DGAT and one MGAT, xi) one T-transcription factor WRII, one DGAT, one MGAT, one oleosin and GPAT, xii) one DGAT and one oleosin, or xiii) one MGAT and one oleosin, and xiv') optionally, a silencing suppressor polypeptide, wherein each exogenous polynucleotide is operably linked to a promoter that is capable of directing the expression of the pol. inucleotide in a plant, part of the vegetative plant, or a non-human organism or part thereof, or seed, respectively. The one or more exogenous polynucleotides may comprise nucleotides, the sequence of which is defined herein. Preferably, the plant, vegetative plant part, non-human organism or part thereof, or seeds is homozygous for one or more exogenous polynucleotides. Preferably, the exogenous polynucleotides are integrated into the genome of the plant, part of the vegetative plant, non-human organism or part thereof, or seeds. The one or more polynucleotides can be provided as separate molecules or they can be provided as a single contiguous molecule. Preferably, the exogenous polynucleotides are integrated into the genome of the plant or organism at a single genetic locus or genetically linked loci, more preferably, in the homozygous state. More preferably, the exogenous integrated polynucleotides are genetically linked with a selectable marker gene such as a herbicide tolerance gene.
[141] [141] In a preferred embodiment, the vegetative plant part, non-human organism or part thereof, or seed comprises a first exogenous polynucleotide encoding a WRII and a second exogenous polynucleotide encoding a DGAT, preferably a DGATI.
[142] [142] In another preferred embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII and a second exogenous polynucleotide encoding a DGAT, preferably a DGATI and a third exogenous polynucleotide that encodes an oleosin.
[143] [143] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, and a fourth exogenous polynucleotide encoding an MGAT, preferably an MGAT2.
[144] [144] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, and a fourth exogenous polynucleotide encoding LEC2 or BBM..
[145] [145] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, a fourth exogenous polynucleotide encoding an MGAT, preferably an MGAT2, and a fifth exogenous polynucleotide encoding LEC2 or BBM.
[146] [146] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, and a fourth exogenous polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding a lipase such as CGi58 polypeptide.
[147] [147] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, a fourth exogenous polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding a lipase, such as a CGi58 polypeptide, and a fifth exogenous polynucleotide encoding LEC2 or BBM.
[148] [148] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, fourth exogenous polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding a lipase such as a CGi58 polypeptide, and a fifth exogenous polynucleotide encoding an MGAT,
[149] [149] In another embodiment, the part of the vegetative plant, the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGAT 1, a third exogenous polynucleotide encoding an oleosin, a fourth exogenous polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding a lipase, such as a CGi58 polypeptide, a fifth exogenous polynucleotide encoding an MGAT, preferably an MGAT2, and a sixth exogenous polynucleotide encoding LEC2 or BBM.
[150] [150] In one embodiment, the seed comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, and a fourth exogenous polynucleotide encoding a MGAT , preferably an MGAT2. Preferably, the seed further comprises a fifth exogenous polynucleotide encoding a GPAT.
[151] [151] Where relevant, instead of a polynucleotide encoding an RNA molecule that inhibits the expression of a gene encoding a lipase, such as a CGi58 polypeptide, the vegetative plant part, the non-human organism or part thereof, or the seed has one or more mutations introduced into the lipase gene, such as a CGi58 gene that confers reduced levels of the lipase polypeptide, when compared to an isogenic vegetative plant part, non-human organism or part thereof, or the seeds devoid of mutation.
[152] [152] In a preferred embodiment, exogenous polynucleotides encoding DGAT and oleosin are operably linked to a constitutive promoter, or a promoter active in green plant tissues, at least before and until flowering, which is capable of direct the expression of polynucleotides in the vegetative plant part, the non-human organism or part thereof, or the seed. In another preferred embodiment, the exogenous polynucleotide encoding WRII, and the RNA molecule that inhibits the expression of a gene encoding a lipase, such as a CGi58 polypeptide, is operably linked to a constitutive promoter, a promoter active in the green tissues of a plant, at least before and until flowering, or an inducible promoter, which is capable of directing the expression of the polynucleotides in the vegetative plant part, the non-human organism or part thereof, or the seed. In yet another preferred embodiment, the exogenous polynucleotides encoding LEC2, BBM and/or MGAT2 are operably linked to an inducible promoter, which is capable of directing the expression of the polynucleotides in the vegetative plant part, the non-human organism or part thereof, or the seed.
[153] [153] In each of the above modalities, the total nonpolar lipid content of the vegetative plant part, or non-human organism or part thereof, or the seed, preferably a plant leaf or part thereof, stem or tuber, is at least about 3%, more preferably at least about 5°5, preferably at least about 7%, more preferably at least about 10%, more preferably at least about 11%, most preferably at least about 11% about 12%, more preferably at least about 13%, more preferably at least about 14%, or more preferably at least about 15% (w/w dry weight or seed weight). In another preferred modality, the total nonpolar lipid content is between 5% and 25%, between 7% and 25%, between 10% and 25%, between 12° and 25%, between 15% and 25%, between 7 % and 20%, between 10% and 20%, between 10% and 15%, between 15% and 20%, between 20% and 25%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 20%, or about 22%, each as a percentage of dry weight or weight of the seed. In a particularly preferred embodiment, the vegetative plant part is a leaf (or leaves) or a portion thereof. In a more preferred embodiment, the vegetative plant part is a leaf portion having a surface area of at least 1 cm2.
[154] [154] In addition, in each of the above modalities, the total TAG content of the vegetative plant part, or non-human organism or part thereof, or the seed, preferably a plant leaf or part of the plant, stem or tuber , is at least about 3°C, more preferably at least about 5°5, preferably at least about 7°5, more preferably at least about 10%, more preferably at least about 11%, more preferably at least about 12%, more preferably at least about 13%, more preferably at least about 14%, more preferably at least about 15%, or more preferably at least about 17% (w/w weight dry or seed weight). In another preferred modality, the total TAG content is between 5% and 30%, between 7% and 30%, between 10% and 30%, between 12% and 30%, between 15% and 30%, between 7% and 30%, between 10% and 30%, between 20° and 28%, between 18% and 25%, between 22% and 30%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 20%, or about 22%, each as a percentage of dry weight or weight of the seed. In a particularly preferred embodiment, the vegetative plant part is a leaf (or leaves) or a portion thereof. In a more preferred embodiment, the vegetative plant part is a leaf portion having a surface area of at least 1 cm2.
[155] [155] In addition, in each of the above modalities, the total lipid content of part of the vegetative plant, or non-human organism or part thereof, or the seed, preferably a plant leaf or part thereof, stem or tuber , is at least about 3%, more preferably at least about 5°5, preferably at least about 7°5, more preferably at least about 10%, more preferably at least about 11%, most preferably at least about 12%, more preferably at least about 13%, more preferably at least about 1%, more preferably at least about 15%, most preferably at least about 17% (w/w dry weight or weight of seed), more preferably at least about 20%, more preferably at least about 25%. In another preferred modality, the total lipid content is between 5% and 35%, between 7% and 35%, between 10% and 35%, between 12% and 35%, between 15% and 35%, between 7°5 and 35%, between 10% and 20%, between 18% and 28%, between 20° and 28%, between 22% and 28%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 20%, about 22%, or about 25%, each as a percentage of the dry weight or seed weight. Typically, the total lipid content of the vegetative plant part, or non-human organism or a part thereof is about 2-3% higher than the nonpolar lipid content. In a particularly preferred embodiment, the vegetative plant part is a leaf (or leaves) or a portion thereof. In a more preferred embodiment, the vegetative plant part is a leaf portion having a surface area of at least 1 cm 2 .
[156] [156] In one embodiment, the vegetative plant part, the non-human organism or part thereof, or the seed, preferably the vegetative plant part, comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a urrt DGAT, preferably a DGATI, a third exogenous polynucleotide encoding a MGAT, preferably a MGAT2, and a fourth exogenous polynucleotide encoding an oleosin, in which the vegetative plant part, non-human organism or part thereof, or seed has one or more or all of the following characteristics: i) a total lipid content of at least 8%, at least
[157] [157] In another embodiment, the vegetative plant part, the non-human organism or part thereof, or the seed, preferably the vegetative plant part, comprises a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, in which the part of the vegetative plant, non-human organism or part thereof, or seed has one or more or all of the following characteristics: i) a total content of TAG of at least 10%, at least 12.5%, at least 15%, or at least 17% (°0 by dry weight or by seed weight), ii) at least 40 times, at least 50 times, at least 60 times, at least 70 times, or at least 100 times higher total TAG content in the vegetative plant part or non-human organism compared to a corresponding vegetative plant part or non-human organism devoid of the exogenous polynucleotides, iii) oleic acid co comprises at least 19% rrienes, at least 22% or at least 25% (% by weight) of the fatty acids in TAG,
[158] [158] Preferably, the characteristics defined for the two modalities above are as in the flowering stage of the plant.
[159] [159] In a fourth aspect, the invention provides a plant seed capable of growing into a plant of the present invention, or obtained from a plant of the present invention, e.g., a non-human organism of the invention that is a plant. In one embodiment, the seed comprises one or more exogenous polynucleotides, as defined herein.
[160] [160] In a fifth aspect, the invention provides a process to obtain a cell with greater capacity to produce one or more nonpolar lipids, the process comprising the steps of: a) introducing into a cell one or more exogenous polynucleotides, b) expressing one or more exogenous polynucleotides in the cell or a cell descendant thereof, C) analyze the lipid content of the cell or progeny, and d) select a cell or cell progeny having an increase in the level of one or more nonpolar lipids relative to to a corresponding cell or descendant cell devoid of exogenous polynucleotides, wherein the one or more exogenous polynucleotides encode i) a wrinkled transcription factor 1 (WRII) and a DGAT, ii) a transcription factor WRII and a DGAT and an oleosin, iii) a WRII transcription factor, a DGAT, an MGAT and an oleosin, iv) a monoacylglycerol acyltransferase (MGAT), v) a diacylglycerol acyltransferase 2 (DGAT2), vi) a MGAT and a gl acyltransferase icerol-3-phosphate (GPAT), vii) one MGAT and one DGAT, viii) one MGAT, one GPAT and one DGAT, ix) one transcription factor WRII and one MGAT, X) one transcription factor WRII, one DGAT and one MGAT, xi) one WRII transcription factor, one DGAT, one MGAT, one oleosin and GPAT, xii) one DGAT and one oleosin, or xiii) one MGAT and one oleosin, and xiv) optionally, a silencing suppressor polypeptide, wherein each exogenous polynucleotide is operably linked to a promoter that is capable of directing expression of the exogenous polynucleotide in the cell or offspring.
[161] [161] In one embodiment, the selected cell or progeny comprises: i) a first exogenous polynucleotide encoding a WRII and a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, ii) a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, and a third exogenous polynucleotide encoding an oleosin, iii) a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide which encodes an oleosin, and a fourth exogenous polynucleotide encoding an MGAT, preferably an MGAT2, iv) a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding a oleosin, and a fourth exogenous polynucleotide encoding LEC2 or BB MV) a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, a fourth exogenous polynucleotide encoding an MGAT, preferably an MGAT2, and a fifth polynucleotide exogenous polynucleotide encoding LEC2 or BBM, vi) a first exogenous polynucleotide encoding a WRII, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third exogenous polynucleotide encoding an oleosin, and a fourth exogenous polynucleotide encoding a molecule of RNA that inhibits the expression of a gene encoding a lipase such as a CGi58 polypeptide, vii) a first exogenous polynucleotide encoding a
[162] [162] In another embodiment, the selected cell or progeny is selected as a plant seed cell and comprises a first exogenous polynucleotide encoding a WR11, a second exogenous polynucleotide encoding a DGAT, preferably a DGATI, a third polynucleotide exogenous polynucleotide encoding an oleosin, and a fourth exogenous polynucleotide encoding an MGAT, preferably an MGAT2. Preferably, the seed further comprises a fifth exogenous polynucleotide encoding a GPAT.
[163] [163] In a preferred embodiment, the exogenous polynucleotides are stably integrated into the genome of the cell or offspring.
[164] [164] In a preferred embodiment, the process further comprises a step of regeneration of a transgenic plant from the cell or cell progeny comprising one or more exogenous polynucleotides. The step of regeneration of a transgenic plant can be carried out before the step of expressing one or more exogenous polynucleotides in the cell or a descendant cell thereof, and/or before the step of analyzing the lipid content of the cell or offspring, and/or before the cell selection step or the cell offspring having an increase in the level of one or more nonpolar lipids. The process may further comprise a step of obtaining seeds from a transgenic plant or plant progeny, wherein the seed or plant progeny comprises one or more exogenous polynucleotides.
[165] [165] The process of the fifth aspect can be used as a screening assay to determine whether a polypeptide encoded by an exogenous polynucleotide has a desired function. The one or more exogenous polynucleotides in this aspect may comprise a sequence as defined above. Furthermore, the one or more exogenous polynucleotides may not be known, prior to the process to encode a WRII transcription factor and a DGAT, a WRII transcription factor and an MGAT, a WRII transcription factor, a DGAT and a MGAT, a transcription factor WRII, one DGAT, one MGAT and one oleosin, one transcription factor WRII, one DGAT, one MGAT, one oleosin and GPAT, one transcription factor WRII, one DGAT one oleosin, one DGAT and one oleosi-na , or an MGAT and an oleosin, but may instead be candidates for them. The process, therefore, can be used as an assay to identify or select the polynucleotides encoding a WRII transcription factor and a DGAT, a WRI1 transcription factor and an MGAT, a WRII transcription factor, a DGAT and an MGAT , a transcription factor WRII, uni DGAT, an MGAT and an oleosin, a transcription factor
[166] [166] In a sixth aspect, the invention provides a transgenic cell or transgenic plant obtained using a process of the invention, or a part of the vegetative plant or seed obtained therefrom, which comprises one or more exogenous polynucleotides.
[167] [167] In a seventh aspect, the invention provides the use of one or more polynucleotides that encode, or a genetic construct comprising polynucleotides that encode: i) a wrinkled transcription factor 1 (WRII) and a DGAT, ii) a transcription factor transcription WRII and a DGAT and an oleosin, iii) a transcription factor WRII, a DGAT, a MGAT and an oleosin, iv) a monoacylglycerol acyltransferase (MGAT), v) a diacylglycerol acyltransferase 2 (DGAT2), vi) a MGAT and a glycerol-3-phosphate acyltransferase (GPAT), vii) a MGAT and a DGAT, viii) a MGAT, a GPAT and a DGAT, ix) a transcription factor WRII and a MGAT, x) a transcription factor WRII, one DGAT and one MGAT, xi) one transcription factor WRII, one DGAT, one MGAT, one oleosin and GPAT, xii) one DGAT and one oleosin, or xiii) one MGAT and one oleosin, and xiv) optionally, one silencing suppressor polypeptide, to produce a transgenic cell, a non-human transgenic organism or a part of it or a trans seed. gene having a greater capacity to produce one or more nonpolar lipids relative to a corresponding cell, non-human organism or part thereof, or seeds devoid of one or more polynucleotides, in which each of the one or more polynucleotides is exogenous to the cell, non-human organism or part thereof, or seed and is operably linked to a promoter which is capable of directing the expression of the polynucleotide in a cell, a non-human organism or a part thereof or a seed, respectively.
[168] [168] In one embodiment, the invention provides the use of a first polynucleotide encoding an RNA or polypeptide transcription factor that enhances the expression of one or more fatty acid or glycolytic acid biosynthesis genes or a cell, a non-human organism or a part thereof, or seeds, together with a second polynucleotide encoding an RNA or a polypeptide involved in the biosynthesis of one or more nonpolar lipids, to produce a transgenic cell, a transgenic non-human organism or part thereof, or a transgenic seed having an increased capacity to produce one or more nonpolar lipids relative to a corresponding cell, non-human organism or part thereof, or seed devoid of the first and second polynucleotides, wherein the first and second polynucleotides are each exogenous to the cell, non-human organism or part thereof, or seeds and are each operatively linked to a premotor that is capable of directing ir the expression of the polynucleotide in the transgenic cell, non-human transgenic organism or part thereof, Qü transgenic seeds, respectively.
[169] [169] In another embodiment, the invention provides the use of one or more polynucleotides to produce a transgenic cell, a transgenic non-human organism or part thereof, or a transgenic seed having a greater capacity to produce one or more nonpolar lipids than to one
[170] [170] In an eighth aspect, the invention provides a process for producing seeds, the process comprising: i) cultivating a plant, various plants, or non-human organism according to the invention, and ii) harvesting seeds from the plant, plants, or non-human organism.
[171] [171] In a preferred embodiment, the process comprises growing a population of at least about 1000 such plants in the field, and harvesting seeds from the population of plants. Seed can be placed in a container and transported outside the field, for example exported outside the field, or stored before use.
[172] [172] In a ninth aspect, the invention provides a fermentation process comprising the steps of: i) providing a container containing a liquid composition comprising a non-human organism of the invention that is suitable for fermentation, and components necessary for the biosynthesis of fatty acids and fermentation, and ii) providing favorable conditions for the fermentation of the liquid composition contained in said vessel.
[173] [173] In a tenth aspect, the invention provides a recovered or extracted lipid obtained by a process of the invention, or obtained from a part of the vegetative plant, non-human organism or part thereof, cell or cell offspring, transgenic plant or seed of the invention. The recovered or extracted lipid, preferably oil such as sern oil, may have an increased TAG content, DAG content, TAG and DAG content, MAG content, the PUFA content, specific PUFA content, or a content of specific fatty acid and/or total nonpolar lipid content. In a preferred mode, MAG is 2-MAG. The extent of increased TAG content, DAG content, TAG and DAG content, MAG content, PUFA content, specific PUFA content, specific fatty acid content and/or total nonpolar lipid content can be as per defined in Feature (i).
[174] [174] In an eleventh aspect, the invention provides an industrial product, produced by a process of the invention, preferably, which is a hydrocarbon product, such as fatty acid esters, preferably methyl esters of fatty acids and/or esters fatty acid ethyls, an alkane such as methane, ethane or a longer chain alkane, a mixture of longer chain alkanes, an alkene, a biofuel, carbon monoxide and/or hydrogen gas, a bioalcohol such as ethanol, propanol, or butanol, biochar, or a combination of carbon monoxide, hydrogen, and biochar.
[175] [175] In a twelfth aspect, the invention provides the use of a plant, part of the vegetative plant, non-human organism or a part thereof, cell or descendant cell, transgenic plant produced by a process of the invention, or a seed or a lipid recovered or extracted from the invention in the manufacture of an industrial product. Industrial product can be as defined above.
[176] [176] In a thirteenth aspect, the invention provides a process for producing fuel, the process comprising: i) reacting a lipid of the present invention with an alcohol, optionally in the presence of a catalyst, to produce the alkyl esters, and ii ) optionally mixing the alkyl esters with petroleum-based fuel. Alkyl esters are preferably methyl esters. The fuel produced by the process may comprise a minimum lipid level of the invention, or a hydrocarbon product produced therefrom, such as at least 10%, at least 20%, or at least 30% by volume.
[177] [177] In a fourteenth aspect, the invention provides a process for producing a synthetic diesel fuel, the process comprising: i) converting a lipid in a vegetative plant, non-human organism or part thereof of the invention to a synthesis gas by gasification , and ii) converting synthesis gas to a biofuel using a metal catalyst or a microbial catalyst.
[178] [178] In a fifteenth aspect, the invention provides a process for producing a biofuel, comprising the process of converting lipid in a part of the vegetative plant, non-human organism or part thereof of the invention to bio-oil by pyrolysis, a bioalcohol by fermentation, or a biogas by gasification or anaerobic digestion.
[179] [179] In a sixteenth aspect, the invention provides a process for producing a food ingredient, the process comprising mixing a plant, part of the vegetative plant thereof, non-human organism or part thereof, cells or descendant cell, plant GMO produced by a process of the invention, seeds, recovered or extracted lipid, or an extract or part thereof, with at least one other food ingredient.
[180] [180] In a seventeenth aspect, the invention provides animal feed, cosmetics or chemicals comprising a plant, vegetative part thereof, non-human organism or part thereof, cells or cell descendants, transgenic plant produced by a process of the invention, seed, or a lipid recovered or extracted from the invention, or an extract or portion thereof.
[181] [181]Of course, when vegetative material from a plant must be harvested because of its Oil content it is desirable to harvest the material when lipid levels are as high as possible. The present inventors have observed an association between the brightness of the vegetative tissue of the plants of the present invention and the oil content, with high levels of lipids being associated with high brightness. Thus, the brightness of the vegetative material can be used as a marker to help determine the timing for harvesting the material.
[182] [182] In another aspect, the invention provides a recombinant cell comprising one or more exogenous polynucleotides and an increased level of one or more nonpolar lipids relative to a corresponding cell lacking one or more exogenous polynucleotides, wherein each of the one or more exogenous polynucleotides are operably linked to a promoter which is capable of directing expression of the polynucleotide in a cell, and wherein one or more or all of the following characteristics apply: (a) the one or more exogenous polynucleotides comprise a first exogenous polynucleotide encoding an RNA or polypeptide transcription factor that enhances the expression of one or more fatty acid or glycolytic biosynthesis genes or a non-human organism or a part thereof, and a second exogenous polynucleotide encoding an RNA or a polypeptide involved in the biosynthesis of one or more nonpolar lipids, (b) if the cell is a cell from a vegetative part of a pl tapir, the cell has a total nonpolar lipid content of at least about 3%, more preferably at least about 5°5, preferably at least about 7°5, more preferably at least about 10°. at least about 11%, more preferably at least about 12%, more preferably at least about 13%, more preferably at least about 14%, or more preferably at least about 15% (w/w),
[183] [183] In one embodiment, the one or more exogenous polynucleotides comprise the first exogenous polynucleotide and the second exogenous polynucleotide, and in which one or more or all of the features (b) to (h) apply.
[184] [184] In another aspect, the present invention provides a method for determining when harvesting a plant optimizes the amount of lipid in the plant's vegetative tissue at harvest, the method comprising i) measuring the brightness of the vegetative tissue, ii) comparing to measured with a predetermined minimum brightness level, and iii) optionally, collecting the plant.
[185] [185] In another aspect, the present invention provides a method for predicting the amount of lipid in the vegetative tissue of a plant, the method comprising measuring the brightness of the vegetative tissue.
[186] [186] In a preferred embodiment of the two aspects above the vegetative tissue is a leaf (leaves) or a portion thereof.
[187] [187] In another aspect, the present invention provides a method for trading a plant or part thereof, comprising obtaining the plant or part comprising a cell of the invention, and trading the plant or plant part obtained for onerous gain.
[188] [188] In one embodiment, the method further comprises one or more or all of: i) cultivating the plant, ii) harvesting part of the plant from the plant, iii) storing the plant or part thereof, or iv) transport the plant or part of it to a different location.
[190] [190] Any model herein should be made to apply, mutatis mutandis, to any other modality unless specifically noted otherwise.
[191] [191] The present invention is not to be limited in scope by the specific modalities described herein, which are intended for purposes of example only. Functionally equivalent products, compositions and methods are clearly within the scope of the invention as described herein.
[192] [192]Throughout this descriptive report, unless specifically indicated otherwise or the context otherwise requires, a reference to a single step, subject composition, group of steps, or group of subject compositions will be made to include one and a plurality (that is, one or more) of those steps, compositions of matter, groups of steps, or groups of compositions of matter.
[193] [193] The invention will hereinafter be described by means of the following non-limiting Examples and with reference to the attached figures. BRIEF DESCRIPTION OF THE ATTACHED DRAWINGS
[194] [194]Figure 1. A representation of several lipid synthesis pathways, most of which converge with, DAG, a central molecule in lipid synthesis. This model includes a possible route for the formation of sn-2 MAG that can be used by a bifunctional MGAT/DGAT to form DAG from glycerol-
[195] [195] Figure 2. Relative DAG and TAG increases in Nicotiana benthamiana leaf tissue transformed with constructs encoding pi 9 (negative control), Arabidopsis thaliana DGATI, Mus musculus MGATI, and a combination of DGATI and MGATI, each expressed a from the 35S promoter. The MGATI enzyme was much more active than the DGATI enzyme in promoting accumulation of DAG and TAG in leaf tissue. The expression of the MGATI gene resulted in twice the accumulation of DAG and TAG in leaf tissue compared to the expression of DGATI individually.
[196] [196] Figure 3. Relative TAG increases in N. benthamiana leaf transformed with constructs encoding pi 9 (nç"gative control), A. thaliana DGATI, M. musculus MGAT2 and a combination of MGAT2 and DGATI. error indicate the standard error of triplicate samples.
[197] [197] Figure 4. Radioactivity (DPM) in MAG, DAG and TAG fractions isolated from transiently transformed N. benthamiana leaf lysates fed with sn-2-MAg[14C] and unlabeled oleic acid over a period of time- course. The constructs used were as for Figure 3.
[198] [198] Figure 5. As per Figure 4, but fed with ["C]G-3-P and unlabeled oleic acid.
[199] [199] Figure 6. TLC plate autoradiogram showing the
[200] [200] Figure 7. TAG levels in Arabidopsis thaliana T2 and T3 seeds transformed with an MGAT2 expressing chimeric DNA relative to parental control (untransformed). Seeds were collected at maturity (dissected). SW: weight of dried seed. TAG levels are reported as µg TAG per 100 µg seed weight.
[201] [201] Figure 8. Total fatty acid content in seed of Arabidopsis thaliana plants transformed with constructs encoding MGATI or MGAT2.
[202] [202]Figure 9. Relative TAG level in transiently transformed N. benthamiana leaf tissue for Arabidopsis thaliana DGATI overexpression.
[203] [203] Figure 10. Conversion of sn-1,2-DAG TAG in N. benthamiana leaf tissue microsome DGAT assay expressing control P19, Arabidopsis thaliana DGATI, and Arabidopsis thaliana DGAT2.
[204] [204] Figure 11. Quantification of total FAME in A. thaliana seeds transformed with pjP3382 and pjP3383.
[205] [205] Figure 12. Maximum TAG levels obtained for different combinations of transiently expressed genes in N. benthamiana leaves. The V2 negative control represents the mean TAG level based on 15 independent replicates.
[206] [206]F'gure 13. Co-expression of genes encoding Arabidopsis thaliana acyltransferase DGATI and A. thaliana transcription factor WRII resulted in a synergistic effect on TAG levels in Nicotiana benthamiana leaves. Data shown are means and standard deviations of five independent infiltrations.
[207] [207] Figure 14. TAG levels in transformed N. benthamiana aerial seedling tissue. Total lipids were extracted from aerial tissues of N. benthamiana seedlings and analyzed by TLC-FID using a DAGE pattern to allow accurate comparison between samples.
[208] [208]Figure 15. Total fatty acid levels of A. thaliana T2 T2 seed populations transformed with control vector (pORE04), M. musculus MGATI (35S:MGAT1) or M. musculus MGAT2 (35S:MGAT2).
[209] [209]Figure 16. Map of the insertion region between the left and right edges of pjP3502. TER Glyma-Lectin denotes the Glycine max lectin terminator; Arath-WRI1, Arabidopsis thaliana transcription factor WRII coding region; PRO Arath-Rubisco SSU, A. thaliana rubisco small subunit promoter; Sesin-Oleosin, Oleosin coding region from Sesame indicum; PRO CaMV35S-Ex2, cauliflower mosaic virus 35S promoter having a duplicate enhancer region; Arath-DGAT1, A. thaliana DGATI acyltransferase coding region; TER Agrtu-NOS, nopaline synthase terminator from Agrobacterium tumefaciens.
[210] [210] Figure 17. Schematic representation of construct pjP3503 including the insertion region between the left and right edges of pjP3503. TER Agrtu-NOS denotes the nopaline terminator synthase from Agrobacterium tumefaciens; Musmu-MGAT2, MGAT2 acyltransferase from Mus Musculus; PRO CaMV24S-Ex2, 35S duplicated enhancer region of cauliflower rosaic virus; TER Glyma-Lectin, Glycine max lectin terminator; Arath-WRI1, Arabidopsis thaliana transcription factor WRII; PRO Arath-Rubisco SSU, A. thaliana rubisco small subunit promoter; Sesin-Oleosin, Sesame indicum oleosin; Arath- DGATI, DGATI acyltransferase from A. thaliana.
[211] [211] Figure 18. TAG yields at different leaf ages of three types of wild-type tobacco plants (wt1-3) and three pjP3503 primary transformants (4, 29, 21). Leaf stages are indicated by 'G', green; 'YG', yellow-green; 'Y', yellow. Plant stages during sampling were bud, wild type 1; first flowers appearing, wild type 2;
[212] [212] Figure 19A. DNA insert containing expression cassettes for Umbelopsis ramanniana DGAT2A expressed by Glycine max debat-conglycinin alpha subunit promoter, Arabidopsis thaliana WR11 expressed by Glycine max kunitz trypsin inhibitor 3 promoter and Mus musculus MGAT2 expressed by Glycine max promoter beta-conglycinin alpha subunit of Glycine max. Gene coding regions and expression cassettes are collectable by restriction digestion.
[213] [213] Figure 19B. DNA insert containing expression cassettes for Arabidopsis thaliana LEC2 and WRII transcription factor genes expressed by inducible Aspergillus alcA promoters, the Arabidopsis thaliana DGATI expressed by the constitutive CaMV-35S promoter and the A"pergillus alcR gene expressed by the promoter Constitutive CSVMV Expression of LEC2 and WRII transcription factors is induced by ethanol or an analogous compound.
[214] [214] Figure 20. Map of pjP3507.
[215] [215] Figure 21. Map of pjP3569.
[216] [216] Unless specifically defined otherwise, all technical and scientific terms used herein are to be considered to have the same meaning as commonly understood by one of ordinary skill in the art (eg, in cell culture, molecular genetics, immunology, immunology). histochemistry, protein chemistry, fatty acid and lipid chemistry, biofuel production, and biochemistry).
[217] [217] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques used in the present invention are standard procedures, well known to those of skill in the art. Such techniques are described and explained throughout the literature in sources such as, j. Perbal, A Practical Guide to Molecular Cloning, john Wiley and Sons (1984), j. Sambrook et al., Molecular Cloning: A Laboratory Manual., Cold Spring Harbor Laboratory Press (1989), TA Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, ( 1988), and JE Coligan et al. (editors) Current Protocols in Immunology, john Wiley & Sons (including all updates to date). selected definitions
[218] [218] The term "non-human transgenic organism" to, for example, a whole plant, alga, non-human animal, or an organism suitable for fermentation, such as a fungus or yeast, comprising an exogenous polynucleotide (transgene) or an exogenous polypeptide . In one embodiment, the transgenic organism in a human is not an animal or part of it. In one embodiment, the non-human transgenic organism is a phototrophic organism (eg, a plant or an alga) capable of obtaining energy from sunlight to synthesize organic compounds for nutrition. In another embodiment, the non-human transgenic organism is a photosynthetic bacterium.
[219] [219] The term "exogenous" in the context of a polynucleotide or polypeptide refers to the polynucleotide or polypeptide when present in a cell that does not naturally comprise the polynucleotide or polypeptide. Said cell is referred to herein as a "recombinant cell" or a "transgenic cell".
[220] [220]As used herein, the term "extracted lipid" refers to a composition extracted from a transgenic organism or part thereof, which comprises at least 60% (w/w) of lipids.
[221] [221] As used herein, the term "non-polar lipid" refers to fatty acids and their derivatives, which are soluble in organic solvents but insoluble in water. Fatty acids can be free fatty acids and/or in an esterified form.
[222] [222] As used herein, the term "seed oil" refers to a composition obtained from the seed/grain of a plant that comprises at least 60% (w/w) lipid, or obtainable from seed. /grain if seed oil is still present in the seed/grain. That is, seed oil of the invention includes senient oil which is present in the seed/grain or part of the mesrus, as well as seed oil which has been extracted from the seed/grain. The seed oil is preferably extracted seed oil. Seed oil is typically a liquid at room temperature.
[223] [223] As used herein, the term "fatty acid" refers to a carboxylic acid with a long aliphatic tail of at least 8 carbon atoms in length, saturated or unsaturated. Typically, fatty acids have a carbon-carbon linkage chain of at least 12 carbons in length. Most naturally occurring fatty acids have an even number of carbon atoms because their biosynthesis involves acetate, which has two carbon atoms. Fatty acids can be in a free (non-esterified) state or in an esterified form as part of a TAG, DAG, MAG, acyl-CoA (thio-ester) bonded, or otherwise covalently bonded. When covalently attached to an esterified form, the fatty acid is referred to herein as an "acyl" group. The fatty acid can be esterified as a phospholipid, such as a phosphatidylcholine (PC), phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol. Saturated fatty acids do not contain any double bonds or other functional groups along the chain. The term "saturated" refers to hydrogen, in which all the carbons (other than the carboxylic acid group [-COOH]) contain as many hydrogens as possible. ^ In other words, the final omega (ój) contains three hydrogen atoms (CH3-) and each carbon within the chain contains two hydrogen atoms (-CH2-). Unsaturated fatty acids are similar in shape to saturated fatty acids, except that one or more alkene functional groups exist along the chain, with each alkene singly replacing the "-CH2-CH2-" bond part of the chain with a doubly bound to the fraction"-
[224] [224] As used herein, the term "polyunsaturated fatty acid" or "PUFA" refers to a fatty acid comprising at least 12 carbon atoms in its carbon chain and at least two alkene groups (carbon-bonds). carbon doubles). The PUFA content of the vegetative plant part, or the non-human organism or part thereof of the invention may be increased or reduced depending on the combination of exogenous polynucleotides expressed in the vegetative plant part, or non-Huriian organism or part thereof or seed of the invention. For example, when an MGAT is expressed the PUFA level typically increases, whereas when DGATI is expressed alone or in combination with WRII, the P'JFA content is typically reduced due to an increase in the level of oleic acid. Also, if LJ12 desaturase activity is reduced, eg. by silencing an endogenous LJ12 desaturase, PUFA content is unlikely to increase in the absence of an exogenous polynucleotide encoding a different LJ12 desaturase. {225]"Monoacylglyceride" or "MAG" is a glyceride in which the glycerol is esterified with a fatty acid." As used herein, MAG comprises an err, sn-1/3 hydroxyl group (also referred to herein as sn-1 or I-MAG MAG or 1/3-MAG) or at the sn-2 position (also referred to herein as 2-MAG), and therefore MAG does not include phosphorylated molecules like PA or PC. MAG is therefore a component of neutral lipids in a cell.
[226] [226] "Diacylglyceride" or "DAG" is a glyceride in which the glycerol is esterified with two fatty acids which may be the same or, preferably, different. As used herein, DAG comprises a hydroxyl group at an sn-1,3 or sn-2 position, and therefore DAG does not include phosphorylated molecules such as PA or PC. DAG is therefore a neutral lipid component of a cell. In the Kennedy synthesis pathway of DAG (Figure 1), the precursor of sn-glycerol-3-phosphate (G-3-P) is esterified with two acyl groups, each coming from a fatty acid coenzyme A ester, in a first reaction catalyzed by a glycerol-3-phosphate acyltransferase (GPAT) at the sn-1 position to form LysoPk, followed by a second acylation at the sn-2 position catalyzed by a lysophosphatidic acid acyltransferase (LPAAT) to form phosphatidic acid ( PAN). This intermediate is then de-phosphorylated to form DAG. In an alternative anabolic pathway (Figure 1), DAG can be formed by the acylation of sn-1 MAG or preferably sn-2 MAG, catalyzed by MGAT. DAG can also be formed from TAG by removal of an acyl group by a lipase, or from PC, essentially, by removal of a choline head group by any of the CPT, PDCT or PLC enzymes (Figure 1) .
[227] [227]"Triacylglyceride" or "TAG" is a glyceride in which the glycerol is esterified with three fatty acids, which may be the same (eg, as in triolein) or, more generally, different. In the Kennedy synthesis pathway of TAG, DAG is formed as described above, and then a third acyl group is esterified to the glycerol backbone by the activity of DGAT. Alternative pathways for TAG formation include one catalyzed by the PDAT enzyme and the MGAT pathway described herein.
[228] [228] As used herein, the term "acyltransferase" refers to a protein that is capable of transferring an acyl-CoA acyl group onto a substrate and includes MGATS, GPATS and DGATS.
[229] [229] As used herein, the term "wrinkled 1" or "WRil" or "WRLI" refers to a transcription factor of the AE 2/ERWEBP class that regulates the expression of various enzymes involved in glycolysis and de novo biosynthesis of fatty acids. WRII has two plant-specific DNA binding domains (AP2/EREB). WRII in at least Arabidopsis also regulates the breakdown of sucrose via glycolysis thus regulating the supply of precursors for fatty acid biosynthesis. In other words, it controls carbon flux from photosynthesis to storage lipids. Wril mutants have a puckered serrant phenotype, seed phenotype, due to a defect in the incorporation of sucrose and glucose into TAGs.
[230] [230] Examples of genes that are transcribed by WRII include, among others, one or more, preferably all, of pyruvate kinase (At5g52920, At3g22960), pyruvate dehydrogenase (PDH) Elalpha subunit (At1gO1090), acetyl-CoA carboxylase (ACCase) , BCCP2 subunit (At5g15530), enoyl-ACP reductase {At2g05990; EAR), phosphoglycerate mutase (At1g22170), cytosolic fructokinase and cytosolic phosphoglycerate mutase, sucrose synthase (SuSy) (see, for example, Liu et al, 201Ob.; Baud et al, 2007; Ruuska et al, 2002).
[231] [231]WRLI contains the conserved domain AP2 {cdOO018). AP2 is a DNA binding domain found in plant transcription regulators such as APETAL2 and EREBP (ethylene-sensitive element binding protein). In EREBPs the domain specifically binds to the 11bp CCG box of the ethylene response element (ERE), an essential promoter element for ethylene responsiveness. EREBPS and the C repeat binding binding factor CBFI, which is involved in. stress response, contain a single copy of the AP2 domain. APETAL2-like proteins, which play a role in plant development, contain two copies.
[232] [232] Other sequence motifs in WRII and its functional homologues include:
[233] [233] As used herein, the term "wrinkled 1" or "WRII" also includes "Wrinkled type 1" or "wrinkled type 1 proteins."
[234] [234] As used herein, the term "monoacylglycerol acyltransferase" or "MGAT" refers to a protein that transfers a fatty acyl group of acyl-CoA to a MAG substrate for the production of DAG. Thus, the term "monoacylglycerol acyltransferase activity" refers to at least the transfer of an acyl group from acyl-CoA to MAG to produce DAG. MGAT is best known for its role in fat absorption in the mammalian intestine, where fatty acids and sn-2 MAG generated from the digestion of dietary fat are again synthesized into TAG in enterocytes for chylomicron synthesis and secretion. MGAT catalyzes the first step of this process, in which the fatty acyl group of acyl-CoA, formed from fatty acids and CoA, and sn-2 MAG are covalently bonded. The term "MGAT", as used herein, includes enzymes that act on sn-1/3 and/or sn-2 MAG substrates to form sn-1,3 DAG and/or sn-1.2/2,3- 0 G, respectively. In one embodiment, MGAT has a preference for sn-2 MAG substrate over sn-1 MAG, or substantially uses only sn-2 MAG as substrate (examples include MGATS described in Cao et al. 2003 (mouse MGATI specificity) to sn2-18: 1-
[235] [235] As used herein, MGAT does not include enzymes that transfer an acyl group, preferentially to LysoPA over MAG, such enzymes are known as LPAATs. That is, an MGAT preferentially uses non-phosphorylated monoacyl substrates, although they may have low catalytic activity on LysoPA. A preferential MGAT has no detectable activity in acylation of LysoPA. As shown here, an MGAT (ie, M. musculus MGAT2) may also have the DGAT function but predominantly functions as a mgat, that is, it has greater catalytic activity as an MGAT than as a DGAT when the activity enzyme is expressed in units of nmoles of product/min/mg of protein (see also Yen et al., 2002).
[236] [236] There are three known classes of MGAT, referred to as, MGATI, MGAT2 and MGAT3, respectively. Homologues of the human MGATI gene {AF384163; SEQ ID NO:7) are present (i.e. sequences are known), at least in chimpanzee, dog, cow, mouse, ratg, ppixe-zebra, Caenorhabaütis elegans, Schizosaccha.romyces pombe, Saccharomyces ce.revisiae, Kluyveromyces lactis , Eremothecium gossypii, Magnaporthe grisea, and Neurospora crassa. Homologs of the human MGAT2 gene (AY157608) are present, at least in chimpanzee, dog, cow, mouse, rat, chicken, zebrafish, fruit fly, and mosquito. Homologues of the human MGAT3 gene (AY229854) are present at least in chimpanzee, dog, cow, and zebrafish. However, homologs from other organisms can be readily identified by methods known in the art for identifying homologous sequences.
[237] [237] Examples of MGATI polypeptides include proteins encoded by MGATI genes from Homo sapiens (AF384163; SEQ ID NO:7), Mus musculus (AF384162; SEQ ID NO:8), Pan troglodytes
[238] [238] As used herein "MGAT pathway" refers to an anabolic pathway, different from the Kennedy pathway for TAG formation, in which DAG is formed by acylation of either sn-1 MAG or preferably sn-2 MAG , catalyzed by MGAT. The DAG can
[239] [239] As used herein, the term "diacylglycerol acyltransferase" (DGAT) refers to a protein that transfers a fatty acyl group of acyl-CoA to a DAG substrate for the production of TAG. Thus, "diacylglycerol acyltransferase activity" refers to the transfer of an acyl group from acyl-CoA to DAG for the production of TAG. DGAT may also have the MGAT function, but predominantly functions as a DGAT, that is, it has greater catalytic activity as a DGAT than as a MGAT when the enzymatic activity is expressed in nmoles/min protein/mg product units ( see, for example, Yen, et. al., 2005).
[240] [240]There are three known types of DGAT, referred to as DGAT 1, and DGAT 2 DGAT 3, respectively. DGATI polypeptides typically have 10 transmembrane domains, DGAT2 polypeptides typically have two transmembrane domains, while DGAT3 polypeptides typically have none and are thought to be soluble in the cytoplasm, not integrated into membranes. Examples of DGAT 1 polypeptides include proteins encoded by DGATI genes from Aspergillus fumigatus (XP 755172.1; SEQ ID NO:347), Arabidopsis thaliana (CAB44774.1; SEQ ID NO:83), Ricinus communis (AAR11479.1; SEQ ID NO:347) 348), Vernicia fordii (ABC94472.1; SEQ ID NO:349), Vernonia galamensis (ABV21945.1 and ABV21946.1; SEQ ID NO:350 and SEQ ID NO:351, respectively), Euonymus' alatus (AAV31083.1 ; SEQ ID NO:352), Caenorhabditis elegans (AAF82410.1; SEQ ID NO:353), Rattus norvegicus (NP_445889.1; SEQ ID NO:354), Homo sapiens (NP_036211.2; SEQ ID NO:355), as well as variants and/or mutants thereof. Examples of DGAT2 oligopeptides include proteins encoded by DGAT2 genes of Ara-bidopsis thaliana (NP_566952.1; SEQ ID NO:2i2), Ricinus communis (AAY16324.1; SEQ ID NO:213), Vernicia fofdii (ABC94474.1; SEQ ID NO:214), Mortierella ramanniana (AAK8417g.1; SEQ ID NO:215), Homo sapiens (Q96PD7.2; SEQ ID NO:j 1Q
[241] [241]Examples of DGAT3 polypeptides include proteins encoded by peanut DGAT3 genes (Arachis hypogaea, Saha, et al., 2006), as well as variants and/or mutants thereof. DGAT has little or no detectable MGAT activity, for example less than 300 pmol/min/mg protein, preferably less than 200 pmol protein/min/mg, more preferably 100 pmol/min/mg protein.
[242] [242] DGAT2 but not DGATI share high sequence homology with the MGAT enzymes, suggesting that the DGAT2 and MGAT genes likely share a common genetic origin. Although multiple isoforms are involved in catalyzing the same step in TAG synthesis, they may play different functional roles as suggested by the differential tissue distribution and subcellular localization of the DGAT/MGAT family of enzymes.
[243] [243]Both MGATI and MGAT2 belong to the same class of acultra.nsferases as DGAT2. Some of the motifs that have been shown to be important for DGAT2 catalytic activity in some DGAT2s are also conserved in. MGAT acyltransferases. Of particular interest is a putative neutral lipid binding domain, with the consensus sequence FLXLXXXN (SEQ ID NO:224), where each X is independently any amino acid except proline, and N is any nonpolar amino acid located within the N-terminal transmembrane followed by a putative glycerol/phospholipid acyltransferase domain region. Motif FLXLXXXN (SEQ ID NO:224) is found in murine DGAT2 (amino acids 81-88) and MGAT1/2, but not in yeast or plant DGAT2S. It is important for murine DGAT2 activity. Other DGAT2 and/or MGAT1/2 sequence motifs include:
[244] [244] As used herein, the term "glycero.1-3-phosphate acyltransferase" or "GPAT" refers to a protein that acylates glycerol-3-phosphate (G-3-P) to form L,YSoPA and/or MAG, forming the latter product, if GPAT also has phosphatase activity in LysoPA. The acyl group that is transferred is typically from acyl-CoZi. Thus, the term "glycerol-3-phosphate acyltransferase activity" refers to the acylation of G-3-P to form LysoPA and/or MAG. The term "GPAT" encompasses enzymes that acylate G-3-P to form sn-1 LPA and/or sn-2 LPA, preferably, sn-2 LPA. In a preferred embodiment, GPAT has phosphatase activity. In a more preferred modality, GPAT is an sn-2 GPAT having phosphatase activity that produces sn-2 MAG.
[245] [245] As used herein, the term "sn-1 glycerol-3-phosphate acyltransferase" (sn-1 GPAT) refers to a protein that acylates sn-glycerol-3-phosphate (G-3-P), to preferably form 1-acyl-sn-glycerol-3-phosphate (sn-1LPA). Thus, the term "sn-1-glycerol-3-phosphate-acyltransferase activity" refers to the acylation of sn-glycerol-3-phosphate to form (sn-) 1-acyl-sn--glycerol-3-phosphate. lPA).
[246] [246] As used herein, the term "sn-2-glycerol-3-phosphate acyltransferase" (sn-2 GPAT) refers to a protein that acylates sn-glycerol-3-phosphate (G-3-P) to form preferably 2-acyl-sn-glycerol-3-phosphate (sn-2 LPA). Thus, the term "sn-2-glycerol-3-phosphate-acyltransferase activity" reflects the acylation of sn-glycerol-3-phosphate to form 2-acyl-sn-glycerol-3-phosphate (sn-2 LPA).
[247] [247]The GPAT family is large and all known members contain two conserved domains, a plsC acyltransferase domain (PFO1553; SEQ ID NO:225) and a HAD-like hydrolase (PF12710; SEQ ID NO:226) superfamily domain. Furthermore, in Arabidopsis thaliana, GPAT4-8, they all contain an N-terminal region homologous to a phosphoserine phosphatase domain (PFO0702; SEQ ID NO:227). GPAT4 GPAT6 and both contain conserved residues that are known to be essential for phosphatase activity, specifically conserved amino acids.
[248] [248] The homologues of GPAT4 (NP 171667.1; SEQ ID NO:144) and GPAT6 (NP_181346.1; SEQ ID NO:145) include AAF02784.1 (Arabidopsis thaliana; SEQ ID NO:146), AAL32544.1 (Arabidopsis thaliana; SEQ ID NO:14j), AAP03413.1 (Oryza sativa; SEQ ID NO:148), ABK25381.1 (Picea sitchensis; SEQ ID NO:149), ACN34546.1 (Zea Mays; SEQ ID NO:150) , BAFO0762.1 (Arabidopsis thaliana; SEQ ID NO:151), BAHO0933.1 (Oryza sativa; SEQ ID NO:152), EAY84189.1 (Oryza sativa; SEQ ID NO:153), EAY98245.1 (Oryza sativa; SEQ ID NO:154), EAZ21484.1 (Oryza sativa; SEQ ID NO:155), EEC71826.1 (Oryza sativa; SEQ ID NO:156), EEC76137.1 (Oryza sativa; SEQ ID NO:157), EEE59882 .1 (Oryza sativa; SEQ ID NO:158), EFJ08963.1 (Selaginella moellendorffii; SEQ ID NO:159), EFJ08964.1 (Selaginella moellendorffii; SEQ ID NO:160), EFJ11200.1 (Selaginella moellendorffii; SEQ ID NO:160), NO:161), EFJ15664.1 (Selaginella moellendorffii; SEQ ID NO:162), EFJ24086.1 (Selaginella moeliendorffii; SEQ ID NO:163), EFJ29816.1 (Selaginella moellendorffii; SEQ ID NO:163) :164), EFJ29817.1 (Selaginella moellendorffii; SEQ ID NO:165), NP_O01044839.1 (Oryza sativa; SEQ ID NO:166), NP_O01045668.1 (Oryza sativa,; SEQ ID NO:167), NP_O01147442.1 (Zea mays; SEQ ID NO:168), NP_O01149307.1 (Zea mays; SEQ ID NO:169), 'NP 001168351.1 (Zea mays; SEQ ID NO:170), AFH02724.1 (Brassica napus; SEQ ID NO:171) NP_191950.2 (Arabidopsis thaliana; SEQ ID NO:172), XP 001765001.1 (Physcomitrella patens; SEQ ID NO:173), XP 00176967(1 (Physcomitrella patens; SEQ ID NO:174),
[249] [249]Conserved motifs and/or residues can be used as a diagnosis based on sequence identification of bifunctional GPAT/phosphatase enzymes. Alternatively, a more rigorous function-based assay could be used. Such an assay involves, for example, feeding cells or microsomes with labeled glycerol-3-phosphate and quantifying the levels of labeled products by thin layer chromatography or a similar technique. Labeled LPA whereas GPAT/phosphatase activity results in the production of rr.arcapped MAG.
[250] [250] As used herein, the term "Oleosin" refers to an amphipathic protein present in the membrane of oil bodies of seed storage tissues (see, for example, Huang, 1996; Lin et al, 2005.; Capuano et al.; al, 2007.; Lui et al, 2009.; Shimada and Hara-Nishimura, 2010).
[251] [251] Plant seeds accumulate 'TAG in subcellular structures called oil bodies. These organelles consist of a TAG core surrounded by a phospholipid monolayer containing various embedded proteins including oleosins (Jolivet et al., 2004). Oleosins represent the most abundant membrane protein. of oily bodies.
[252] [252]Oleosins are of low M, (15-26,000). Within each of the seed species, there are usually two or more oleosins of different M,. Each oleosin molecule contains a relatively hydrophilic N-terminal domain (eg about 48 amino acid residues), an entirely central hydrophobic domain (eg about 70-80 amino acid residues), which is particularly rich in amino acids. aliphatic such as alanine, glycine, leucine, isoleucine and valine, and an amphipathic α-helix domain (eg, about about 33 amino acid residues), at or near the C-terminus. Generally, the central extension of hydrophobic residues is inserted into the lipid core and the C-terminal amphipathic and/or N-terminal amphipathic are located on the surface of oil bodies, with embedded positively charged residues and In a phospholipid monolayer and those negatively charged ones exposed to the outside.
[253] [253] As used herein, the term "oleosin" encompasses polyoleosins that have multiple oleosin polypeptides fused together as a single polypeptide, for example, 2x, 4x or 6x oleosin peptides, and calcium-binding kaleosins (Froissard et al. 2009), and sterol-binding sterolosins. However, in general, a large proportion of oil body oleosins will not be kaleosins and/or sterolosins.
[254] [254] A substantial number of oleosin protein sequences, and nucleotide sequences encoding them, are known from a large number of different plant species.
[255] [255] As used herein, the term a "polypeptide involved in starch biosynthesis" refers to any polypeptide, the down-regulation of which in a cell below normal (wild-type) levels result in a reduction in the level of synthesis of starch and an increase in starch levels. An example of such a polypeptide is AGPase.
[256] [256] As used herein, the term "ADP-glucose phosphorylase" or "AGPase" refers to an enzyme that regulates starch biosynthesis, which catalyzes the conversion of glucose-l-phosphate and ATP to AOP-glucose, which serves as the building block of starch polymers. The active form of the AGPase enzyme consists of 2 large errt and 2 small subunits. [257jThe AOPase enzyme in plants exists primarily as a tetramer that consists of 2 large and 2 small subunits. Although these subunits differ in their catalytic and regulatory functions depending on species (Kuhn et al. 2009), in plants the small subunit generally exhibits catalytic activity. The molecular weight of the small subunit is approximately 50-55 kOa. The molecular weight of the large subunit is approximately 55-60 kDa. The plant enzyme is strongly activated by 3-phosphoglycerate (PGA), a carbon dioxide fixation product; in the absence of PGA, the enzyme has only about 3% of its activity. Plant AGPase is also strongly inhibited by inorganic phosphate (Pi). In contrast, bacterial and algal AGPase exist as 50 kDa homotetramers. The algae enzyme, like its plant counterpart, is activated by PGA and inhibited by Pi, while the bacterial enzyme is activated by fructose-1,6-bisphosphate (FBP) and inhibited by AMP and Pi.
[258] [258] As used herein, the term "polypeptide involved in lipid degradation and/or reducing lipid content" refers to any polypeptide, the downregulation of a cell in which below normal (wild-type) levels result in an increase in the level of oil, such as fatty acids and/or TAGs, in the cell, preferably a cell from the vegetative tissue of a plant. Examples of such polypeptides include, among others, lipases, or a lipase such as CGi58 polypeptide, SUGAR DEPENDENT triacylglycerol lipase-I (see, for example, Kelly et al., 2012) or a lipase described in WO 2009/027335.
[259] [259]As used herein, the term "lipase" refers to a protein that hydrolyzes fats to glycerol and fatty acids. Thus, the term "lipase activity" refers to the hydrolysis of fats to glycerol and fatty acids.
[260] [260] As used herein, the term "CGi58" refers to a soluble acyl-CoA dependent lysophosphatidic acid acyltransferase also known in the art as "At4g24160" (in plants) and "Ictlp" (in yeast). The plant gene, like the locus. of the Arabidopsis gene, At4g24160, is expressed as two alternative transcripts: a longer full-length isoform (At4g24160.1) and a shorter isoform (At4g24160.2) missing a portion of the 3' end (see james et al, 2010; Ghosh et al, 2009; US 201000221400). Both mRNAs code for a protein that is homologous to the human CGI-58 protein and other orthologous members of this a/j3 hydrolase (ABHD) family. In one embodiment, the CGI58 protein (At4g24160) contains three motifs that are conserved across plant species: a GXSXG lipase motif (SEQ ID NO:419), an HX(4)D acyltransferase motif (SEQ ID NO:420), and a VX(3)HGF motif, a likely lipid binding motif (SEQ ID NO:421). The human CGI-58 protein has lysophosphatidic acid acyltransferase (LPAAT) activity but not lipase activity. In contrast, plant and yeast proteins possess a canonical lipase sequence GXSXG motif (SEQ ID NCi:419), which is absent in vertebrates (human, mouse, and zebrafish proteins). Although CGI58 plant and yeast proteins appear to have detectable amounts of TAG lipase and phospholipase D activities in addition to LPAAT activity, the human protein does not.
[261] [261] Disruption of homologous CGI-58 gene in Arabidopsis thaliana results in accumulation of neutral lipid droplets in mature sheets. Mass spectroscopy of lipid droplets isolated from cgi-58 loss-of-function mutants showed that they contain triacylglycerols with common leaf-specific fatty acids. Leaves from mature cgi-58 plants show a marked increase in absolute levels of triacylglycerol, more than 10-fold higher than in wild-type plants. Lipid levels in oil storage seeds of loss-of-function cgi-58 plants remained unchanged, and with different mutations in j3-oxidation, cgi-58 seeds germinated and grew normally, without the need for sucrose rescue (james et al. al., 2010).
[262] [262]Examples of CGi58 polypeptides include proteins from Arabidopsis thaliana (NP 194147.2; SEQ ID NO:429), Brachypodium distachyon (XP_003578450.1; SEQ ID NO:430), Glycine max (XP OC3523638.1; SEQ ID NO:429), :431), Zea mays (NP 001149013.1; SEQ ID NO:432), Sorghum bicolor (XP_002460538.1; SEQ ID NO:433), Ricinus communis (XP 002510485.1; SEQ ID NO:434), Medicago truncatula (XP 003.603.733.1; SEQ ID NO:435), and Oryza sativa (EAZ09J82.1; SEQ ID NO:436). {263] As used herein, the term "leafy cotyledon 2" or "LEC2" refers to a B3 domain transcription factor that participates in zygotic and somatic embryogenesis. Its ectopic expression facilitates embryogenesis from vegetative plant tissues (Alemanno et al., 2008). LEC2 also comprises a DNA binding region found hitherto only in plant proteins. Examples of polypeptides, LEC2 include proteins from Arabidopsis thaliana (NP 564304.1) (SEQ ID NO:442), Medicago truncatula (CAA42938.1) (SEQ ID NO:443) and Brassica napus (ADO16343.1) (SEQ ID NO:442) :444).
[264] [264] As used herein, the term "BABY BOOM" or "BBM" refers to a transcription factor that induces AP2/ERF regeneration under culture conditions that do not normally support regeneration in wild-type plants. Ectopic expression of BBM genes from Brassica napus (BnBBM) in B. napus and Arabidopsis induces spontaneous somatic embryogenesis and organogenesis from seedlings grown in hormone-free basal medium (Boutilier et al., 2002). In tobacco, ectopic BBM expression is sufficient to induce adventitious shoots and root regeneration in a basal medium, but exogenous cytokinin is required for somatic embryo formation (SE) (Srinivasan et al., 2007). Examples of BBM polypeptides include proteins from Arabidopsis thaliana (N1_197245.2) (SEQ ID NO:445) and Medicago truncate (AAW82334.1) (SEQ ID NO:446).
[265] [265] As used herein, the term "FAD2" refers to a membrane-bound delta-12 desaturase fatty acid that desaturates oleic acid (18:1^9) to produce linoleic acid (C18:2L1.9, l2),
[266] [266] As used herein, the term "epoxygenase" or "fatty acid epoxygenase" refers to an enzyme that introduces an epoxy group into a fatty acid, resulting in the production of an epoxy fatty acid. In the preferred embodiment, the epoxy group is introduced at the 12th carbon in a fatty acid chain, in which case 2.-epoxygenase is an L12-epoxygenase, especially from a C16 or C18 fatty acid chain. The epoxygenase can be an A9-epoxygenase, an LJ15 epoxygenase, or act at a different position on the acyl chain, as known in the art. The epoxygenase may be of the E'450 class. Preferred epoxygenases are of the monooxygenase class as described in WO98/46762. Several epoxygenases or presumed epoxygenases have been cloned and are known in the art. Other examples of epoxygenases include proteins comprising an amino acid sequence given in SEQ ID NO:21 of WO 2009/129582, polypeptides encoded by genes from Crepis panzeastina (CAA76156, Lee et al, 1998.), Stokesia laevis (AAR2381515 , Hatanaka et al., 2004) (monooxygenase type), Euphorbia lagascae (AAL62063) (P450 type), human CYP2J2 (arachi acid)donic epoxygenase, U37143); Human CYPIAI (arachi)donic acid epoxygenase, K03191), as well as variants and/or mutants.
[267] [267] As used herein, the term, "hydroxylase" or "fatty acid hydroxylase" refers to an enzyme that introduces a hydroxyl group into a fatty acid, resulting in the production of a hydroxylated fatty acid. In a preferred embodiment, the hydroxyl group is introduced at the 2nd, 12th and/or 17th carbon in a C18 fatty acid chain. Preferably, the hydroxyl group is introduced at the 12th carbon, in which case the hydroxylase is an L 12 -hydroxylase. In another preferred embodiment, the hydroxyl group is introduced at the 15th carbon in the C16 fatty acid chain. Hydroxylases can also have an enzymatic activity, like a fatty acid desaturase. Examples of genes encoding Lj12-hydroxylases include those from Ricinus communis (AAC9010, van de Loo, 1995); Physaria lindheimeri, (ABQO1458, Dauk et al, 2007); Lesquerella fendleri, (AAC32755, Broun et al, 1998.); Daucus carota (AAK30206); Fatty acid hydroxylases that hydroxylate the terminal fatty acids, for example: A. thaliana CYP86A1 (P48422, fatty acids (Ú-hydroxylase); Vicia sativa CYP94A1 (P98188, fatty acid @-hydroxylase); mouse CYP2E1 (X62595, acid) lauric cu-1 hydroxylase); rat CYP4A1 (M57718, fatty acid ú-hydroxylase), as well as variants and/or mutants.
[268] [268] As used herein, the term "conjugase" or "fatty acid conjugase" refers to an enzyme capable of forming a conjugated bond in the acyl chain of a fatty acid. Examples of conjugases include those encoded by genes from Calendula officinal.is (AF343064, Qiu et al, 2001); Vernicia fo.rdii (AAN87574, Dyer et al, 2002); Punishes granatum (AY178446, Iwabuchi et al, 2003) and Trichosanthes kirilowii (AY178444, Iwabuchi et al, 2003); as well as variants and/or mutants.
[269] [269] As used herein, the term "acetylenase" or "fatty acid acetylenase" refers to an enzyme that introduces a triple bond into a fatty acid, resulting in the ejection of an acetylenic fatty acid. In one embodiment, the triple bond is introduced at the 2nd, 6th, 12th and/or 17th carbon in a C18 fatty acid chain. Examples of acetylenases include those from Helianthus annuus (AA038032, ABC59684), as well as variants and/or mutants.
[270] [270] Examples of such gene-modifying fatty acids include proteins according to the following Accession numbers that are grouped by putative function, and homologs from other species: LI12 acetylenases ABCO0769, CAA76158, AAO38036, AAO38032; Lj12 conjugases AAG42259, AAG42260, AAN87574; A12 desaturases P46313, ABS18716, AAS57577, AAL61825, AAF04093, AAF04094; LJ12 epoxygenases XP_O01840127, CAA76156, AAR23815; LJ12 hydroxylases ACF37070, AAC32755, ABQO1458, AAC49010; and P450 LJ12 enzymes such as AF406732.
[271] [271] As used herein, c) term "vegetative tissue" or "vegetative part of the plant" is any plant tissue, organ or part other than the sexually reproducing organs of plants, especially seeds having organs, flowers, pollen, fruits and seeds. Vegetative tissues and parts include at least plant leaves, stems (including buds and shoots, i'nas excluding heads), tubers and roots, but exclude flowers, pollen, seed including tegument, embryo and endosperm, fruits including mesocarp tissue, seed pods, and seed heads. In one modaliclade, the vegetative part of the plant is a part of the aerial plan'Ca. In another embodiment, the vegetative plant part is a green part like a leaf or stem.
[272] [272] As used herein, the term "wild-type" or its variations refers to a cell, non-human organism or part thereof that has not been genetically modified.
[273] [273] The term "correspondent" refers to a vegetative part of the plant, a cell or non-human oroanism or part thereof, or seed that has the same or similar genetic furnish as a vegetative part of the plant, a cell. or a non-human organism or part thereof, or a member of the invention, but which has not been modified, as described herein (for example, a vegetative part of the plant, a non-human cell or organism or part thereof, or a member is devoid of an exogenous polynucleotide encoding an MGAT or an exogenous MGAT). In a preferred embodiment, a part of the vegetative plant, a cell, or non-human organism or part thereof, or seed is at the same stage of development as a vegetative part of the plant, a cell, or non-human organism or part thereof, or seed of the invention. For example, if the non-human organism is a plant, then preferably the corresponding plant is also flowering.
[274] [274] As used herein "compared to" refers to comparing the non-polar lipid levels or non-polar lipid content of the non-human transgenic organism or part thereof expressing one or more exogenous polynucleotides or exogenous polypeptides with an organism transgenic non-human or part thereof without the one or more exogenous polynucleotides or polypeptides.
[275] [275] As used herein, "increased capacity to produce non-polar lipid" is a relative term, which refers to the total amount of non-polar lipid to be produced by a non-human cell or organism or part thereof of the invention is increased relative to to a corresponding cell, or non-human organism or part thereof. In one embodiment, the TAG and/or polyunsaturated fatty acid content of the non-polar lipid is increased.
[276] [276] As used herein, "germinate at a rate substantially the same as for a wild-type of the corresponding plant" refers to the seeds of a plant of the invention being relatively fertile when compared to the seeds of a wild-type plant. without the defined exogenous polynucleotides. In one embodiment, the number of seeds that germinate, for example, when grown under ideal greenhouse conditions for the plant species," is at least 75%, more preferably at least 90%, than when compared to corresponding wild-type seed. In another embodiment, seeds that germinate, for example, when cultivated under ideal greenhouse conditions for the plant species, will grow at a rate that, on average, is at least 75%, more preferably at least 90% of that when compared to the corresponding wild-type plants.
[277] [277] As used herein, the term "an isolated or recombinant polynucleotide that regulates the production and/or activity of an endogenous enzyme" or variations thereof, refers to a polynucleotide that encodes an RNA molecule that regulates the production and /or the activity (eg encoding an s1RNA, hpRNAi), or regulate production and/or activity.e to less (eg it is an S1RNA that can be delivered directly to, for example, a cell) of an endogenous enzyme, e.g., DGAT, sn--1-glycerol-3-phosphate acyltransferase (GPAT), 1-acylglycerol-3-phosphate acyltransferase (LPAAT), acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT), phosphatase from phosphatidic acid (PAP), AGPase or delta-12 fatty acid desaturase (FAD2) or a combination of two or more of these.
[278] [278] As used herein, the term "on a weight basis" refers to the weight of a substance (eg TAG, DAG, fatty acids) as a percentage of the weight of the composition comprising the substance (eg , seeds, leaves). For example, if the transgenic seed has 25 µg total of acids
[279] [279] As used herein, the term "on a relative basis" refers to the amount of a substance of a composition that comprises the substance, compared to a corresponding composition, as a percentage.
[280] [280] As used herein, the term "relative non-lipid content" refers to the expression of the nonpolar lipid content of a cell, organism or part thereof, or lipid extracted from it, compared to a corresponding cell, organism or part thereof, or the lipid extracted from the corresponding cell, organism or part thereof, as a percentage. For example, if the transgenic seed has 25 µg total fatty acids, while the corresponding seeds had 20 µg total fatty acids, the increase in nonpolar lipid content on a relative basis equals 25%.
[281] [281] As used herein, the term "biofuel" refers to any type of fuel, as typically used to power machinery such as automobiles, trucks, or petroleum-powered engines, whose energy is derived from biological carbon fixation. Biofuels include fuels derived from the conversion of biomass as well as solid biomass, liquid fuels and biogas. Examples of biofuels include bioalcohol, biodiesel, synthetic diesel, vegetable oil, bioethers, biogas, synthesis gas, solid biofuels, algae-derived fuel, biohydrogen, biomethanol, 2,5-Dimethylfuran (DMF), biodimethyl ether (bioDME), diesel from Fischer-Tropsch, biohydrogen diesel, mixed alcohols and wood diesel.
[282] [282] As used herein, the term "bioalcohol" refers to biologically produced alcohols, eg, ePnoi, propanol, and butanol. Bioalcohols are produced by the action of microorganisms and/or enzymes, through the fermentation of sugars, cellulose or hemicellulose.
[283] [283] As used herein, the term "biodiesel" refers to a composition comprising ethyl or methyl esters of fatty acids derived from nonpolar lipids by or transesterification.
[284] [284] As used herein, the term "synthetic diesel" refers to a form of diesel fuel that is derived from renewable raw materials rather than the fossil raw material used in most diesel fuels.
[285] [285] As used herein, the term "vegetable oil" includes either a pure vegetable oil (or pure vegetable oil) or a waste vegetable oil (by a product of other industries). (286] As used herein, the term "bioethers" refers to those compounds that act as octane enhancers.
[287] [287] As used herein, the term "biogas" refers to methane or a flammable mixture of methane and other gases produced by the anaerobic digestion of organic matter by anaerobes.
[288] [288] As used herein, the term "synthesis gas" refers to a mixture of gases that contains varying amounts of carbon monoxide and hydrogen, and eventually other hydrocarbons, produced by the partial combustion of biomass.
[289] [289] As used herein, the term "solid biofuels" includes wood, sawdust, grass, and non-food energy crops.
[290] [290] As used herein, the term "cellulosic ethanol" refers to ethanol produced from cellulose or hemicellulose.
[291] [291] As used herein, the term "algae fuel" refers to a biofuel made from algae and includes algae biodiesel, biobutanol, biogasoline, methane, ethanol, and the equivalent of vegetable oil made from of algae.
[292] [292] As used herein, the term "bio-hydrogen" refers to biologically produced hydrogen, eg, algae.
[293] [293] As used herein, the term "biomethanol" refers to ,
[294] [294] As used herein, the term "2,5-Dimethylfuran" or "DMF" refers to a heterocyclic compound with the formula (CH3)2C4H2O. DMF is a derivative of furan that is derivable from cellulose.
[295] [295] As used herein, the term "biodimethyl ether" or "B1ODME", also known as methoxymethane, refers to an organic compound with the formula CH3OCH3. Synthesis gas can be converted to methanol in the presence of a catalyst (usually copper based), with subsequent dehydration of methanol in the presence of a different catalyst (eg silica-alumina) which results in the production of DME.
[296] [296] As used herein, the term "Fischer-Tropsch" refers to a set of chemical reactions that convert a mixture of carbon monoxide and hydrogen into liquid hydrocarbons. Synthesis gas can first be conditioned using, for example, a displacement of water gas to achieve the necessary H2/CO ratio. The conversion takes place in the presence of a catalyst, usually iron or cobalt. Temperature, pressure and catalyst determine whether a light or heavy syncrude is produced. For example, at 330°C most gasoline and olefins are produced while at 180° to 250°C most diesel and waxes are produced. Liquids produced from synthesis gas, which comprise various hydrocarbon fractions, are very clean straight-chain hydrocarbons (sulphur-free). Fischer-Tropsch diesel can be produced directly, but a higher yield is achieved if Fischer-Tropsch wax is produced first, followed by hydrocracking. [297] As used herein, the term "biochar" refers to coal from biomass, for example, by pyrolysis of biomass.
[299] [299] As used herein, the term "industrial product" refers to a hydrocarbon product that is predominantly made of carbon and hydrogen, such as methyl and/or ethyl esters of fatty acids or alkanes, such as methane, mixtures. • from longer-chain alkanes, which are typically liquid at room temperature, a biofuel, carbon monoxide and/or hydrogen, or a bioalcohol such as ethanol, propanol, or butanol, or biochar. The term "industrial product" is intended to include intermediate products that can be converted to other industrial products, for example, synthesis gas is itself considered an industrial product that can be used to synthesize a hydrocarbon product, which is also considered a product industrial. The term industrial product as used herein includes both pure forms of the above compounds, or more commonly a mixture of various compounds and components, for example the hydrocarbon product may contain a range of carbon chain lengths, such as. well understood in the technique.
[300] [300] As used herein, "glow" refers to an optical phenomenon caused when evaluating the appearance of a surface. Gloss assessment describes the ability of a surface to reflect directed light.
[301] [301]Throughout this descriptive report, the word "comprise.", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a declared element, integer or step, or group of elements, integers or steps , but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
[302] [302] The term "and/or", eg "X and/or Y" should be understood as either "X and Y" or "X or Y", and should be taken to provide explicit support for both. meanings or for any meaning.
[303] [303] As used herein, the term about, unless stated otherwise, refers to +/-10%, more preferably +/- 5%, more preferably +/- 2%, most preferably +/- 1 %, even more preferably +/- 0.5%, of the indicated value. Production of Diacylglycerols and Triacylglycerols
[304] [304] In one embodiment, the vegetative plant part, non-human transgenic organism or part of the invention produces higher levels of nonpolar lipids, such as DAG or TAG, preferably both, than a vegetative plant part, non-human organism correspondent or part thereof. In one example, the transgenic plants of the present invention produce seeds, leaves, leaf portions of at least 1cm2 err, surface areas, stems and/or tubers having an increased nonpolar lipid content as DAG or TAG, preferably both, when compared to corresponding seeds, leaves, portions of leaves of at least 1cm2 in surface area, stems or tubers. The non-polar lipid content of the vegetative plant part, non-human organism or a part thereof is 0.5% higher in relation to weight when compared to a corresponding non-human organism or part thereof or as further defined in Characteristic (I ).
[305] [305] In another embodiment, the vegetative plant part, the non-human transgenic organism or part thereof, preferably a plant or seed, produces DAGS and/or TAGS that are enriched for one or more particular fatty acids. A "broad spectrum of fatty acids can be incorporated into DAGs and/or TAGS, including saturated and unsaturated fatty acids and short chain and long chain fatty acids. Some non-limiting examples of fatty acids that can be incorporated into
[306] [306] In one embodiment of the invention, the vegetative plant part, the non-human transgenic organism or part thereof, preferably a plant or seed, is transformed with a chimeric DNA encoding a MGAT that may or may not have DGAT activity . The expression of MGAT preferentially results in higher levels of non-polar lipids, such as DAG or TAG and/or increased non-polar lipid yield in said non-human transgenic organism or part of it. In a preferred embodiment, the transgenic non-human organism is a plant.
[307] [307] In a further embodiment, the vegetative plant part, transgenic non-human organism or part thereof is transformed with a chimeric DNA encoding a GPAT or a DGAT. Preferably, the vegetative plant part or non-human transgenic organism is transformed with both chimeric DNAs, which are preferably covalently linked to a DNA molecule, such as, for example, a single T-DNA molecule.
[308] [308] Yang et al. (2010) describe two glycerol-3-phosphate (acyltransferases GPAT4 and GPAT6) from Arabidopsis with preferentially sn-2 and phosphatase activity that are capable of producing sn-2 MAG from glycerol-3-phosphate (G-3-P) ( Figure 1).
[309] [309] Combining a bifunctional GPAT/phosphatase with an MGAT produces a new DAG synthesis pathway using G-3-P as a substrate and two acyl groups derived from acyl-CoZi as the other substrates. In the same way,. combining a bifunctional GPAT/phosphatase with an MGAT which has DGAT activity produces a novel TAG synthesis pathway using glycerol-3-phosphate as a substrate and three acyl groups derived from acyl-CoA as other substrates.
[310] [310] Thus, in one embodiment of the invention, the non-human transgenic organism or part of it is co-transformed with a bifunctional GPAT/phosphatase and with a MGAT that has no DGAT activity. This would result in the production of MAG by bifunctional GPAT/phosphatase which would then be converted to DAG by MGAT and then TAG by a native DGAT or other activity.
[311] [311] In another embodiment of the invention, the transgenic non-human organism or part thereof, preferably from a plant or seed, is co-transformed with chimeric DNA encoding a bifunctional GPAT/phosphatase and a MGAT which has DGAT activity. This would result in the production of MAG by bifunctional GPAT/phosphatase which would then be converted to DAG and then followed by TAG by MGAT.
[312] [312] In another embodiment, one or more endogenous GPATS with no detectable phosphatase activity are silenced, eg, one or more genes encoding GPATS that acylate glycerol-3-phosphate to form LPA in the Kennedy pathway (eg. , Arabidopsis GPATI) is silenced.
[313] [313] In another modality, the part of the vegetative plant, non-human transgenic organism or part thereof, preferably a plant or seed, is transformed with a chimeric IJNA that codes for a DGATI, a DGAT2, a wrinkled transcription factor 1 ( WRII), an oleosin, or a silencing suppressor polypeptide. Chimeric DNAs are preferably covalently linked to a DNA molecule, such as a single T-DNA molecule, and part of the vegetative plant, non-human transgenic organism or part thereof is preferably homozygous for the molecule. DNA inserted into your genome.
[314] [314] Substrate preferences can be manipulated in the novel DAG and TAG synthesis pathways by, for example, providing transgenic H1246 yeast strains that express MGAT variants with a concentration of a particular free fatty acid (eg, DHA) that prevents complementation by the wild-type MGAT gene. Only variants capable of using the free fatty acid for riacid would grow. Several cycles of modified MG{T would result in the production of MGAT with greater preference for particular fatty acids.
[315] [315] The various complementations to the Kennedy cije pathway and supplementations described above can be performed in any cell type, due to the ubiquitous nature of the initial glycerol-3-phosphate substrate. In one modality, the use of transgenes results in increased oil yields.
[316] [316] The terms "polynucleotide" and "nucleic acid" are used interchangeably. They refer to a polymeric form of nucleotides of any length, whether ribonucleotides or deoxyribonucleotides, or analogs thereof. A polynucleotide of the invention may be of genomic, cDNA, semi-synthetic or synthetic origin, double-stranded or single-stranded origin and by virtue of its origin or manipulation: (1) is not associated with all or a portion of a polynucleotide with the which it is associated with in nature, (2) is linked to a polynucleotide other than the one to which it is linked in nature, or (3) does not occur in nature. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA {tRNA ), ribosomal RNA (rRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, DNA isolated from any sequence, RNA isolated from any sequence, chimeric DNA from any sequence, nucleic acid probes, and primers.
[317] [317] By "isolated polynucleotide" is meant a polynucleotide that has been generally separated from the polynucleotide sequences with which it is associated or linked in its native state. Preferably, the isolated polynucleotide is at least 60% free, more preferably at least 75% free, more preferably at least 90% free of polynucleotide sequences with which it is naturally associated or linked.
[318] [318] As used herein, the term "gene" is to be taken in its broadest context and includes sequences comprising the region of deoxyribonucleotides and transcribed, if translated, the protein coding region of a structural gene and include sequences located adjacent to the coding region at both the 5' and 3' of a distance of at least about 2 kb on each side, and which are involved in gene expression. In this regard, the gene includes control signals, such as promoters, enhancers, termination and/or polyadenylation signals, which are naturally associated with uw. particular gene, or heterologous control signals, in which case the gene is referred to as a "chimeric gene". Sequences which are located within the 5' coding region of the protein and which are present in the mRNA are referred to as 5' untranslated sequences. Sequences which are located in the 3' coding region of the protein or downstream and which are present in the mRNA are referred to as 3' untranslated sequences. The term "gene" encompasses both the cDNA and genomic forms of a gene. The genomic form or a clone gene contains the coding region that can be interrupted with non-coding sequences termed "introns", "intervening regions", or "intervening sequences." Introns are segments of a gene that are transcribed into nuclear RNA (nRNA). Introns can contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or basic transcript; intr-ons, therefore, are not present in the transcribed mRNA. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term "gene" includes a synthetic or fusion molecule that encodes all or a portion of the proteins of the invention described herein and a nucleotide sequence complementary to any of the above.
[319] [319] As used herein, "chimeric DNA" refers to any molecule of DNA that is not found naturally in nature, also referred to herein as a "DNA construct". Typically, chimeric DNA comprises regulatory and transcripts or sequences encoding proteins that are not naturally found together in nature. Thus, chimeric DNA may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged differently than found in nature. The open reading frame may or may not be linked to its upstream and downstream regulatory elements. The open reading frame can be incorporated, for example, into the plant genome, an unnatural site, or into a replicon or vector in which it is not found naturally as a bacterial plasmid or viral vector. "Chimeric DNA" is not limited to DNA molecules that are replicable in a host, but includes DNA capable of being linked to a replicon by, for example, specific adapter sequences.
[320] [320] A "transgene" is a gene that has been introduced into the genome by a transformation process. The term includes a gene from a descendant cell, plant, seed, non-human organism or part thereof, which has been introduced into the genome of such a progenitor cell. Such descendant cells etc. they can be at least a 3" or 4" generation of progenitor cell offspring, which was the transformed primary cell. The offspring can be produced by sexual reproduction or vegetatively as, for example, from potato tubers or sugar cane. The term "genetically modified", and variations thereof, is a generic term that includes introducing a gene into a cell by transformation or transduction, mutating a gene into a cell and genetically altering or modulating the regulation of a gene in a cell. cell, or the offspring of any cell modified as described above.
[321] [321] A "genomic region" as used herein refers to a position within the genome where a transgene, or a group of trans genes (also referred to here as a cluster), has been inserted into a cell, or its predecessor. . These regions comprise only those nucleotides that have been incorporated by human intervention, as by the methods described herein.
[322] [322] A "recombinant polynucleotide" of the invention refers to a nucleic acid molecule that has been constructed or modified by artificial recombinant methods. The recombinant polynucleotide can be present in a cell in an altered amount or expressed at an altered rate (for example, in the case of mRNA) from its native state. In one embodiment, the polynucleotide is introduced into a cell that does not naturally comprise the polynucleotide. Typically an exogenous DNA is used as a template for the transcription of mRNA, which is then translated to a sequence of amino acid residues encoding a polypeptide of the present invention within the transformed cell. In another embodiment, the polynucleotide is endogenous to the cell and its expression is altered by recombinant means, for example, an exogenous control sequence is introduced upstream of an endogenous gene of interest to allow the transformed cell to express the polypeptide encoded by the gene.
[323] [323] A recombinant polynucleotide of the present invention includes polynucleotides that have not been separated from other components of the cell-based or cell-free expression system in which it is present, and polynucleotides produced in such cell-based or cell-free systems. which are subsequently purified away from at least some of the other components. The polynucleotide can be a contiguous stretch of naturally occurring nucleotides, or comprise two or more contiguous stretches of nucleotides from different sources (naturally occurring and/or synthetic) joined to form a single polynucleotide.
[324] [324] With respect to defined polynucleotides, it should be noted that higher identity percentages than those given above will encompass preferred modalities. Thus, if applicable, depending on the minimum values of %5 percent identity, it is preferred that the polynucleotide comprises a polynucleotide sequence that is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, most preferably at least 99.1 %, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, most preferably more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and most preferably at least 99.9% identical to the relevant SEQ ID NO indicated.
[325] [325] A polynucleotide of, or useful for, the present invention can selectively hybridize, under stringent conditions, to a polynucleotide as defined herein. As used herein, stringent conditions are those that: (1) utilize during hybridization a denaturing agent such as formamide,
[326] [326]The polynucleotides of the present invention Kjodem possess, in relation to naturally occurring molecules, one or nal mutations that are deletions, insertions or substitutions of residues from. nucleotides. Polynucleotides that have mutations to the reference sequence may be naturally occurring (i.e., isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis or DNA shuffling on the nucleic acid , as described above). Polynucleotide to Reduce Endogenous Protein Expression Levels RNA Interference
[327] [327] RNA interference (RNA1) is particularly useful for specifically inhibiting the production of a particular protein. While not wishing to be bound by theory, Waterhouse et al. (1998) provided a model for the mechanism by which dsRNA (RNA duplex) can be used to reduce protein production. This technology is based on the presence of dsRNA molecules, which contain a sequence that is essentially identical to the mRNA of the gene of interest or part of it. Conveniently, dsRNAj can be produced from a single promoter in a recombinant vector or a host cell, wherein the sense and antisense sequences are flanked by an unrelated sequence that allows the sense and antisense sequences to hybridize to form the molecule. dsRNA with the unrelated sequence forming a loop structure. The design and production of suitable dsRNA molecules is within the ability of one of skill in the art, especially considered Waterhouse et al. (1998), Smith et al. (2000), WO 99/32619, WO 99/53050, WO 99/49029, and WO 01/34815.
[328] [328] In one example, a DNA that is introduced directs the synthesis of at least partially double-stranded RNA products with homology to the target gene to be inactivated. Therefore, DNA comprises both sense and antisense sequences which, when transcribed into RNA, can hybridize to form the double-stranded RNA region. In one embodiment of the invention, the sense and antisense sequences are separated by a spacer region comprising an intron which, when transcribed into RNA, are joined from the outside. This arrangement has been shown to result in greater gene silencing efficiency. The double-stranded region can comprise one or two RNA molecules, transcribed from either one or two DNA regions. The presence of the double-stranded molecule is likely to trigger a response from an endogenous system that destroys the double-stranded RNA as well as the transcription of the target gene's homologous RNA, effectively reducing or eliminating the activity of the target gene.
[329] [329] The length of the sense and antisense sequences that hybridize each must be at least 19 contiguous nucleotides. The full-length sequence corresponding to the entire gene transcript can be used. The degree of identity of the sense and antisense sequences to the target transcript must be at least 85%, at least 90%, or at least 95-100%. The RNA molecule can, of course, comprise unrelated sequences that can function to stabilize the molecule. The RNA molecule can be expressed under the control of an RNA polymerase II or RNA polymerase promoter
[330] [330] Small preferential interfering RNA molecules ("S1RNA") comprise a nucleotide sequence that is identical to about 19-21 contiguous nucleotides of the target mRNA. Preferably, the s1RNA sequence starts with the AA dinucleotide, comprises a GC content of about 30-70% (preferably 30-60%, more preferably 40-60% and most preferably about 45%-55% ), and has no high percent nucleotide sequence identity whatsoever beyond the target in the genome of the organism into which it is to be introduced, for example, as determined by standard BLAST search. microRNA
[331] [331]MicroRNAs (abbreviated miRNAs) are usually 19-25 nucleotides (commonly about 20-24 nucleotides in plants) of non-coding RNA molecules that are derived from larger precursors that form the imperfect stem-loop structures.
[332] [332]miRNAs bind to complementary sequences on target messenger RNA (mRNA) transcripts, often resulting in translational repression or target degradation and gene silencing.
[333] [333]In plant cells, precursor miRNA molecules must be extensively processed in the nucleus. The pri-rr'.iRNA (containing one or more "hairpin" regions, or double-stranded sites as well as the usual 5' "cap" and polyadenylated tail of an mRNA) is processed to a smaller miRNA precursor molecule that also includes a stem-loop or inverted-fold structure and is called "pre-miRNA". In plants, pre-miRNAs are cleaved by distinct DICER-like enzymes (DCL), producing . miRNA:m.iRNA* duplex. Before transporting outside the core, these duplexes are methylated.
[334] [334] In the cytoplasm, the miRNA strand of dupieZ miRNA:miRNA* is selectively incorporated in µm. complex d.j silencing,
[336] [336] Gene silencing after homology-dependent transcription (ie, cosuppression) describes the loss of expression of a transgene and related endogenous genes or viral in transgenic β-lantas. Cosuppression often, but not always, occurs when transgene transcripts are abundant, and is generally considered to be triggered, at the level of mRNA processing, localization, and/or degradation. There are several models to explain how cosuppression works (see, in Taylor, 1997).
[337] [337] One model, the "quantitative" or "RNA threshold" model, proposes that cells can compete for the accumulation of large amounts of transgene transcripts, but only up to a point. Once the critical threshold has been crossed, sequence-dependent degradation of both the transgene transcript and the related endogenous gene is initiated. It has been proposed that this mode of cosuppression can be triggered following the synthesis of copy RNA molecules (CRNA) by reverse transcription of the excess transgene mRNA, presumably by RNA-dependent RNA polymerases. These cRNAs can. hybridize with transgene and endogenous mRNAs, unusual hybrids directing homologous transcripts for degradation. However, this model does not account for reports suggesting that cosuppression can apparently occur in the absence of transgene transcript and/or without detectable accumulation of transgene transcripts.
[338] [338] To take these data into account, a second model, the "qualitative" or "aberrant RNA" model, proposes that interactions between transgene RNA and DNA and/or between endogenous and introduced DNAS lead to methylation of transcribed regions of genes. Methylated genes are proposed to produce RNAs that are somewhat aberrant, their anomalous features triggering specific degradation of all related transcripts. These aberrant RNAs can be produced by complex transgene loci, particularly those that contain inverted repeats.
[339] [339] A third model proposes that intermolecular base pairing between transcripts, rather than cRNA-mRNA hybrids generated by the action of an RNA-dependent RNA polymerase, can trigger cosuppression. This base pairing becomes more common as transcript levels rise, the putative double-stranded regions triggering targeted degradation. of homologous transcripts. A similar model proposes intramolecular base pairing rather than intermolecular base pairing between transcripts.
[340] [340] Cosuppression involves introducing an extra copy of a gene or a fragment thereof into a plant in no sense orientation with respect to a promoter for its expression. A person skilled in the art would appreciate that the size of the sense fragment, its correspondence to target gene regions, and its degree of sequence identity to the target gene may vary. In some cases, the additional copy of the gene sequence interferes with the expression of the target plant gene Reference is made to WO 97/20936 and EP 0465572 for methods of implementing cosuppression approaches.
[341] [341] The term "antisense polynucleotide" should be taken to mean a DNA or RNA, or a combination thereof, molecule that is complementary to at least a portion of a specific mRNA molecule that encodes an endogenous polypeptide capable of interfere with a post-transcription event such as mRNA translation. The use of antisense methods is well known in the art (see, for example, G. Hartmann and S. Endres, Manual of Antisense Methodology, Kluwer (1999)). The use of antisense techniques in plants was reviewed by Bourque (1995) and Senior (1998). Bourque (1995) lists a large number of examples of how antisense sequences have been used in plant systems as a method of gene inactivation. Bourque also claims that achieving 100% inhibition of any enzyme activity may not be necessary, as inhibition will more than likely result in measurable changes in the system. Senior (1998) claims that antisense methods are now a very well-established technique for manipulating gene expression.
[342] [342] In one embodiment, the antisense polynucleotide hybridizes under physiological conditions, that is, is the antisense polynucleotide (which is wholly or partially single-stranded) is at least capable of forming a double-stranded polynucleotide with an mRNA encoding a protein as a endogenous enzyme, eg, DGAT, GPAT, LPAA, LPCAT, P.AP, AGPase, in normal conditions in a cell.
[343] [343] Antisense molecules can include sequences that correspond to structural genes or to sequences that effect control over gene expression or junction event.
[344] [344]The length of the antisense sequence should be at least 19 contiguous nucleotides, preferably at least 50 nucleotides, and more preferably at least 100, 200, 500 or 1000 nucleotides. The full sequence complementary to the full-length gene transcript can be used. The color is most preferably 100-2000 nucleotides. The degree d: identity of the antisense sequence to the targeted transcript should be at least 90% and more preferably 95-100%. The antisense RNA molecule can, of course, comprise unrelated sequences that might function to stabilize the molecule. Catalytic Polynucleotides
[345] [345] The term "catalytic polynucleotide" refers to a DNA molecule or DNA-containing molecule (also known in the art as a "deoxyribozyme") or an RNA or RNA-containing molecule (also known as a "ribozyme") that specifically recognizes a distinct substrate and catalyzes the chemical modification of that substrate. Nucleic acid bases in the catalytic nucleic acid can be A, C, G, T (and U for RNA bases)
[346] [346] Typically, catalytic nucleic acid contains an antisense sequence for specific recognition of a target nucleic acid, and a nucleic acid cleaving enzymatic activity (also referred to herein as the "catalytic domain"). The types of ribozymes that are particularly useful in this invention are hammerhead ribozymes (Haseloff and Gerlach, 198'; Perriman et al., 1992) and hairpin ribozymes (Zolotukhin et al., 1996; Klein et al., 1998; Shippy et al., 1992) 1999).
[347] [347] Ribozymes useful in the invention and DNA Fodifying ribozymes (pc) may be chemically synthesized using methods well known in the art. technique. Ribozymes can further be prepared from a DNA molecule (which in transcription generates an RNA molecule) operably linked to an RNA Polymerase promoter, for example, the promoter for T7 RNA polymerase or SP6 RNA polymerase. In a separate embodiment, DNA can be inserted into an expression cassette or transcription cassette. After "the synthesis, the RNA molecule can be modified by binding to a DNA molecule that has the capacity to stabilize the ribozyme and make it resistant to RNase.
[348] [348] As with antisense oligonucleotides, "small interfering RNA and microRNA described herein, catalytic polynucleotides useful in the invention must be capable of "hybridizing" the target nucleic acid molecule under "physiological conditions", namely, those conditions within a plant cell, alga or fungus. Recombinant vectors
[349] [349] One embodiment of the present invention includes a recombinant vector which comprises at least one polynucleotide defined herein and is capable of 'delivering the polynucleotide to a host cell. Vectors include recombinant expression vectors. Recombinant vectors contain the heterologous polynucleotide sequences, that is, polynucleotide sequences which are not naturally found adjacent to a polynucleotide as defined herein, which preferably are derived from a different species. The vector can be RNA or DNA, either prokaryotic or eukaryotic, and typically is a viral vector, derived from a virus, or a plasmid. Additional plasmid vectors typically include nucleic acid sequences that provide for easy selection, amplification and transformation of the expression cassette in prokaryotic cells, e.g., pUC-derived, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, pBS-derived vectors, or binary vectors containing one or more T-DNA regions. Additional nucleic acid sequences include origins of replication to provide for autonomic replication; of the vector, selectable marker genes, preferably encoding antibiotics or herbicide resistance, multiple single cloning sites provide for multiple nucleic acid sequence insertion sites or genes encoded in the nucleic acid backbone, and sequences that enhance cell transformation prokaryotic and eukaryotic (especially from plants).
[350] [350]"Operably linked", as used herein, refers to a functional relationship between two or more segments of nucleic acids (eg, DNA). Typically, it refers to.
[351] [351] When there are multiple promoters present, each. one can independently be the same or different.
[352] [352] Recombinant vectors may also contain: (a) one or more secretion signals, which encode signal peptide sequences, to allow a polypeptide defined herein to be secreted from the cell which produces the polypeptide, or which provides localization of the expressed polypeptide, for example, for retention of the polypeptide in the endoplasmic reticulum (ER) in the cell, or transfer in a plastid, and/or (b) contain fusion sequences that lead to the expression of nucleic acid molecules, such as proteins. Fusion. Examples of suitable signal segments include any signal segment capable of directing secretion or localization of a defined polypeptide. Preferred signal segments include, but are not limited to, Nicotiana nectarin signal peptide (US 5,939,288), the tobacco extensin signal, soy oleosin binding protein signal. Recombinant vectors may also include intervening and/or untranslated sequences around and/or within the nucleic acid sequence of a polynucleotide as defined herein.
[353] [353] To facilitate identification of transformants, the recombinant vector desirably comprises a selectable or screenable marker gene, or in addition to the nucleic acid sequence of a polynucleotide as defined herein. By "marker gene" is meant a gene that confers a distinct phenotype on cells expressing the marker gene and thus allows these transformed cells to be distinguished from cells lacking the marker. A selectable marker gene confers a trait for which it can "select" based on resistance to a selective agent (eg, an herbicide, antibiotic, radiation, heat, or other treatment to damage untransformed cells). A screenable marker gene (or reporter gene) confers a characteristic that can be identified through observation or testing, i.e., "screening" {e.g., j²-glucuronidase, GFP, luciferase, or activity of other enzymes not present in cells unprocessed). The marker gene and nucleotide sequence of interest do not have to be linked, as co-transformation of unlinked genes, as for example described in US 4,399,216, is also an efficient process of, for example, plant transformation . The actual choice of a marker is not crucial as long as it is functional (ie selective) in combination with the cells of choice such as a plant cell.
[354] [354] Examples of bacterial selectable markers are markers that confer resistance to antibiotics such as ampicillin, erythromycin, chloramphenicol, tetracycline, or resistance, preferably, resistance to kanamycin.
[356] [356] Preferably, the recombinant vector is stably incorporated into the genome of the cell, such as the plant cell. Thus, the recombinant vector may comprise appropriate elements that allow the vector to be incorporated into the genome or a chromosome of the cell. Expression vectorQ
[357] [357] As used herein, an "expression vector" is a DNA or RNA vector that is capable of transforming a host cell and effecting the expression of one or more specified polynucleotides. Preferably, the expression vector is also capable of replicating within the host cell. Expression vectors can be prokaryotic or eukaryotic, and are typically viruses or plasmids. The expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in host cells of the present invention, including, from bacteria, fungi, endoparasites, arthropods, animal, algal, and plant cells . Particularly preferred expression vectors of the present invention can direct gene expression in algae, yeast and/or plant cells.
[358] [358] The expression vectors of the present invention contain regulatory sequences, such as transcription control sequences, translational control sequences, origins of replication and other regulatory sequences that are compatible with the host cell, and that control the expression of polynucleotides of the present invention. In particular, the expression vectors of the present invention include transcription control sequences. Transcription control sequences are sequences that control the initiation, elongation, and termination of transcription. Transcription control sequences are particularly important those that control the initiation of transcription, such as the promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can fuse in at least one of the recombinant cells of the present invention. The choice of regulatory sequences used depends on the target organism such as a plant and/or the target Organ or tissue of interest. Such regulatory sequences can be obtained from any eukaryotic organism, such as olanta plants or viruses, or can be chemically synthesized. A variety of such transcription control sequences are well known to those skilled in the art. Particularly preferred transcription control sequences are promoters active in directing transcription in plants, either constitutively or tissue-phase and/or tissue-specific, depending on the use of the plant or part(s) thereof.
[359] [359] A series of vectors suitable for the stable transfection of plant cells or for the establishment of transgenic plants has been described in, for example, Pouwels et al., Cloning Vectors: A Laboratory Manual., 1985, supp. 1987, Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989, and Gelvin et al., Plant Molecular Biology Manual., Kluwer Academic Publishers, 1990. Typically, plant expression vectors include, for example, one or plus cloned plant genes under the transcriptional control of the 5' and 3' regulatory sequences and a dominant selection marker. Such plant expression vectors may also contain a promoter regulatory region (e.g., a regulatory region inducible or constitutive, environmentally or developmentally regulated, cell or tissue-specific or expression controls), an initiation site for transcription initiation, a ribosome binding site, an RNA signal processing, a transcription termination site, and/or a polyadenylation signal.
[360] [360]A number of constitutive promoters that are active in plant cells have been described. Suitable promoters for constitutive expression in plants include, but are not limited to, cauliflower mosaic virus (CaMV) 35S promoter, Figwort mosaic virus (FMV) 35S, the reed bacilliform virus promoter, the virus promoter Mottle yellow commelina, light-inducible ribulose-1,5-bis-phosphate carboxylase small subunit promoter, rice cytosolic triosephosphate isomerase promoter, Arabidopsis adenine phosphoribosyl promoter, rice actin 1 gene promoter, a mannopine synthase and octopine synthetase promoters, the Adh promoter, the sucrose synthase promoter, the R gene complex promoter, and the chlorophyll a/j3 binding protein gene promoter. Such promoters can be used to create DNA vectors that have been expressed in plants, see, for example, WO 84/02913. All of these promoters have been used to create various types of plant expressible recombinant DNA vectors.
[361] [361] For the purposes of expression in tissues of plant origin, such as leaf, root seed or stem, it is preferred that the promoters used in the present invention have a relatively high expression in those specific tissues. For this purpose, one can choose from a range of gene promoters with tissue or cell-specific or enhanced expression. Examples of such promoters described in the literature include, the chloroplast glutamine synthetase GS2 promoter from pea, the chloroplast fructose-1,6 bisphosphatase-promoter from wheat, the photosynthetic nuclear ST-LS 1 from potato promoter, the kinase promoter serine/threonine and the glucoamylase (CHS) promoter from Arabidopsis thaliana. Also reported to be active in photosynthetically active tissues are the ribulose-1,5-biphosphate carboxylase promoter from east larch (Larix laricin), the promoter for the CAB gene, CAB6 from pine, the promoter for the Cab-l gene from wheat, the promoter for the Cab-1 gene from spinach, the promoter for the Cab 1R gene from rice, pyruvate, the orthophosphate dikiinase promoter (PPDK) from Zea mays, the promoter for the Lhcbl gene *2 from tobacco, the Arabidopsis thaliana SUC2 sucrose -H30 symporter promoter, and the promoter for spinach thylakoid membrane protein genes (Psalj, PsaF, PsaE, PC, FNR, AtpC, AtpD, Cab, RbcS). Other promoters for cx/j3 chlorophyll binding proteins can also be used in the present invention, such as the promoters for white mustard (Sinapis alba) LhcB gene and PsbP gene.
[362] [362] A variety of plant gene promoters that are regulated in response to environmental, chemical, hormonal and/or developmental signals can also be used for the expression of RNA binding protein genes in plant cells, including promoters regulated by (1) heat, (2) light (eg pea RbcS-3A promoter, corn RbcS promoter), (3) hormones such as abscisic acid, (4) injury (eg Wunl ), or (5) chemicals such as methyl jasmonate, salicylic acid, hormonal steroids, alcohol, protective agents (WO 97/06269), or it may also be advantageous to employ (6) organ-specific promoters.
[363] [363] As used herein, the term "storage organ-specific plant promoter" refers to a promoter that preferentially, when compared to other plant tissues, directs gene transcription in a storage organ. of the plant. Preferably, the promoter only directs expression of a gene of interest in the storage Organ, and/or expression of the gene of interest in other parts of the plant such as leaves are not detectable by Northern blot analysis and/or RT-PCR. Normally, the promoter directs gene expression during the growth and development of the storage organ, particularly during the phase of synthesis and accumulation of storage compounds in the storage organ. Such promoters can direct expression of the aene in the entire storage organ of the plant or to a part of it, such as the integument of embryos, or the cotyledon(s) of seeds of dicotyledonous plants or c) endosperm or aleurone layer from the seeds of monocotyledonous plants.
[364] [364] For expression purposes in plant dissipative tissues such as potato plant tuber, tomato fruit, or soybean seeds, canola, cotton, Zea mays, wheat, rice, and barley it is preferred than the promoters used in the present invention have a relatively high expression in those specific tissues. A number of tuber-specific expression or enhancement gene promoters are known, including the class I pattyria promoter, the promoter for potato tuber ADPGPP genes, both small and large subunits, the sucrose synthase promoter, the promoter for major tuber proteins, including the 22 kO protein complexes and proteinase inhibitors, the promoter for the linked granule starch synthetase (GBSS) gene, and other class I and II patatin promoters. Other promoters can also be used to express a protein in specific tissues such as seeds or fruits. The promoter for B-conglycinin or other sequence-specific promoters such as napin, zein, linin and phaseolin promoters can be used. Root specific promoters can also be used. An example of such a promoter is the promoter for o. acid chitinase gene. Expression in root tissue can also be achieved using the proinotor-specific CaMV 35S root sub-domains, which have been identified.
[365] [365] In a particularly preferred embodiment, the promoter directs expression in tissues and organs where lipid biosynthesis takes place. Such promoters can act in seed development, at the appropriate time to modify the lipid composition in seeds.
[366] [366] In one embodiment, the promoter is a plant-specific promoter of storage organs. In one embodiment, the organ storage unit promoter is a seed-specific promoter. In a more preferred embodiment, the promoter directs expression preferentially in the cotyledons of a dicotyledonous plant or in the endosperm of a monocotyledonous plant, over expression in the seed embryo or relative to other plant organs such as leaves. The preferred promoters for seed-specific expression are: 1) promoters of genes encoding enzymes involved in lipid biosynthesis and seed accumulation, such as desaturases and elongases, 2) promoters of genes encoding seed storage proteins, and 3 ) the promoters of genes that encode enzymes involved in carbohydrate biosynthesis and seed accumulation. Suitable seed-specific promoters are rapeseed, the napin gene promoter region (US 5,608,152), the USP Vicia faba promoter (Baumlein et al., 1991), the Arabidopsis oleosin promoter (WO 98/45461), the phaseolin promoter from Phaseolus vulgaris (USA
[367] [367] In another embodiment, the plant storage organ-specific proinotor is a tuber-specific promoter.
[368] [368] In another embodiment, the plant storage organ-specific promoter is a fruit-specific promoter. Examples include, but are not limited to, tomato polygalacturonase, E8 and PDS promoters, as well as the apple ACC oxidase promoter (for review, see Potenza et al., 2004). In a preferred embodiment, the promoter would preferentially express expression in the edible parts of the fruit, for example, the pith of the fruit, in relation to the skin of the fruit or the seed within the fruit.
[369] [369] In one embodiment, the inducible promoter is the alc system of Aspergillus nidulans. Examples of inducible expression systems that can be used in place of the Aspergillus nidulans alc sisterna are described in a review by Pad-idani (2003) and Corrado and Karali (2009). These include a system based on tetracycline repressor (TetR) and inducible tetracycline (Gatz, 1997), systems based on tetracycline repressor and tetracycline inactivatable (Weinmann et al.,
[370] [370] In another embodiment, the inducible promoter is a safener-inducible promoter such as the maize ln2-1 or ln2-2 promoter (Hershey and Stoner, 1991), the safener-inducible promoter is the GST- promoter 27 from corn (jepson et al., 1994), or the GH2/4 promoter from soybean (Ulmasov et al., 1995).
[371] [371] Safeners are a group of several structurally diverse chemical products used to increase a plant's tolerance to the toxic effects of a herbicidal compound. Examples of these compounds include naphthalic anhydride and N,N-dialyl-2,2-dichloroacetamide (DDCA), which protect corn and sorghum against thiocarbamate herbicides; ciomethrinil, which protects sorghum against methochlor; triapentenol, which protects soy against metribuzin; and substituted benzenesulfonamides, which increase the tolerance of several cereal crop species to sulfonylurea herbicides.
[372] [372] In another embodiment, the inducible promoter is an inducible senescence promoter such as the senescence-inducible SAG (senescence-associated gene) 12 and Arabidopsis SAG 13 promoter (Gan, 1-995; Gan and Amasino, 1995). ) and LSC54 from Brassica napus (Buchanan-Wollaston, 1994).
[373] [373] For expression in leaf-specific vegetative tissue promoters, such as ribulose bisphosphate carboxylase (RBCS) promoters, can be used. For example, the genes
[374] [374] In some cases, for example when LEC2 or BBM is recombinantly expressed, it may be desirable that the transgene is not expressed at high levels. An example of a promoter that can be used in such circumstances is a truncated napin A promoter that retains the seed-specific expression pattern but with a reduced expression level (Tan et al., 2011).
[375] [375] The 5' untranslated leader sequence may be derived from the promoter selected to express the heterologous gene sequence of the polynucleotide of the present invention, or it may be heterologous with respect to the coding region of the enzyme to be produced, and may be specifically modified , if desired, in order to increase the translation of the mRNA. For a review of optimizing transgene expression, see Koziel et al. (1996). The 5' untranslated regions can also be obtained from plant viral RNAs (tobacco mosaic virus, Tobacco etch virus, corn dwarf mosaic virus, alfalfa mosaic virus, among others) to from suitable eukaryotic genes, plant genes (chlorophyll a/b binding protein leader gene from wheat and maize), or from a synthetic gene sequence. The present invention is not limited to constructs where the untranslated region is derived from the 5' untranslated sequence which accompanies the promoter sequence. The leader sequence can also be derived from an unrelated promoter or coding sequence. Leader sequences useful in the context of the present invention comprise the Hsp70 maize leader (US 5362865 and US 5859347), and the TMV omega element.
[376] [376] Transcription termination is accomplished by a 3' untranslated DNA sequence operably linked to the expression vector for the polynucleotide of interest. The 3' untranslated region of a recombinant DNA molecule contains a polyadenylation signal that functions in plants to cause the addition of adenylate nucleotides to the 3' end. of RNA. The 3' untranslated region can be obtained from several genes that are expressed in plant cells. The 3' untranslated region nopaline synthase, the 3' untranslated region of the pea small subunit Rubisco oene, the 3' untranslated region of the 7S soy storage protein gene are commonly used in this capacity. The 3' transcribed, untranslated regions containing the polyadenylate signal from the tumor-induced plasmid genes in Agrobacterium (Ti) are also suitable.
[377] [377] Recombinant DNA technologies can be used to improve the expression of a transformed polynucleotide by manipulation, eg, the number of copies of the polynucleotide in a host cell, the efficiency with which polynucleotides are transcribed, the efficiency with which transcriptions results are translated, and the efficiency of post-translational modifications. Recombinant techniques useful for increasing the expression of polynucleotides as defined herein include, among others, operably linking the polynucleotide to a high copy number of plasmids, integrating the polynucleotide molecule into one or more chromosomes of the host cell, adding sequences of vector to plasmid stability, substitutions or modifications of transcription control signals (eg promoters, operators,
[378] [378] Nucleic acid transfer can be used to deliver an exogenous polynucleotide to a cell and comprise one, preferably two, boundary sequences and a polynucleotide of interest. Nucleic acid transfer may or may not encode a selectable marker. Preferably, the transfer nucleic acid is part of a binary vector in a bacterium, where the binary vector further comprises elements that allow replication of the vector in the bacterium, selection, or maintenance of bacterial cells that contain the binary vector. After transfer to a eukaryotic cell, the transfer of the nucleic acid component of the binary vector is capable of integration into the eukaryotic cell genome.
[379] [379] As used herein, the term "extrachromosomal transfer nucleic acid" refers to a nucleic acid molecule that is capable of being transferred from a bacterium, such as Agrobacterium sp., to a eukaryotic cell, such as a leaf cell. plant. An extrachromosomal transfer nucleic acid is a genetic element that is well known as an element capable of being transferred, with the subsequent integration of a nucleotide sequence contained within its boundaries into the genome of the recipient cell. In this regard, a transfer nucleic acid is typically flanked by two "border" sequences, although in some cases, a single border on one side may be used and the second end of the transferred nucleic acid is randomly generated in the transfer process. A polynucleotide of interest is generally positioned between the left boundary sequence and the right boundary sequence of a transfer nucleic acid. The polynucleotide contained in the transfer nucleic acid can be operably linked to a variety of different promoters and regulatory terminator elements that facilitate its expression, i.e., transcription and/or translation of the polynucleotide. Transfer DNAS (T-DNAS) of Agrobacterium sp. such as Agrobacterium tuinefaciens or Agrobacterium rhizogenes, and man-made variants/mutants are probably the best characterized examples of transfer nucleic acids. Another example is P-DNA ("plant DNA"), which comprises T-DNA from plant boundary sequences.
[380] [380] As used herein, "T-DNA" refers to, for example, T-DNA from a Ti plasmid from Agrobacterium tumefaciens or from a Ri plasmid from Agrobacterium rhizogenes, or man-made variants thereof, that function as T-DNA. The T-DNA can comprise an entire T-DNA including the right and left border sequences, but it need only comprise the minimum sequences necessary in cis for the transfer, i.e., the right border sequence and the T-sequence border DNA. The T-DNAS of the invention were inserted therein, at any point between the right and left border sequences (if present), the polynucleotide of interest flanked by target sites for a site-specific recombinase. Sequences encoding factors necessary in trans for the transfer of the T-DNA to a plant cell, such as vir genes, can be inserted into the T-DNA, or can be present in the same replicon as the T-DNA, or preferentially , be in trans in a compatible replicon in the Agrobacterium host. Such "binary vector systems" are well known in the art.
[381] [381] As used herein, "P-DNA" refers to a transfer nucleic acid isolated from a plant genome, or man-made variants/mutants thereof, and comprises, at either end, or at one end only. , a T-DNA boundary-like sequence. The boundary sequence preferably shares at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90% or at least 95%, but less than 100% identity sequence, with a T-DNA border sequence from Agrobacterium sp such as Agrobacterium tumefaciens or Agrobacterium rhizogenes. Thus, P-DNA can be used in place of T-DNAs to transfer a nucleotide sequence contained in the P-DNA from, for example, Agrobacterium, to another cell. The P-DNA, prior to insertion of the exogenous polynucleotide that is to be transferred, can be modified to facilitate cloning and should preferably not encode all proteins. P-DNA is characterized by the fact that it contains at least one right border sequence and, preferably, also one left border sequence.
[382] [382] As used herein, a "boundary" sequence of a transfer nucleic acid can be isolated from a selected organism, such as a plant or bacteria, or will be a man-made variant/mutant. The boundary sequence promotes and facilitates the transfer of the polynucleotide to which it is attached, and may facilitate its integration into the recipient cell's genome. In one embodiment, a boundary sequence is between 5-100 base pairs (bp) in length, 10-80 bp in length, 15-75 bp in length, 15-60 bp in length, 15-50 bp in length in length, 15-40 sc in length, 15-30 sc in length, 16-30 sc in length, 20-30 sc in length, 21-30 sc in length, 22-30 sc in con1primentQ, 23-30 sc in length, 24-30 sc in length, 25-30 sc in length, or 26-3'0 sc in length. Boundary sequences of T-DNA from Agrobacterium sp. are well known in the art and include those described by E.ll Lacroix et al. (2008), Tzfira and Citovsky (2006) and Glevin (2003).
[383] [383] While traditionally only Agrobacterium sp. has been used to transfer genes to plant cells, there are now a large number of systems that have been identified/developed that act in a similar way to Agrobacterium sp. Several non-Agrobacterium species have recently been genetically engineered to be competent for gene transfer (Chung et al., 2006; Broothaerts et al., 2005). These include Rhizobium sp. NGR234, Sinorhizobium meliloti and Mezorhizobium loti. Bacteria are made corupetent for gene transfer, providing the bacteria with the machinery necessary for the transformation process, that is, a set of virulence genes encoded by an Agrobacterium Ti plasmid and the T-DNA segment that resides in a separate small binary plasmid.
[384] [384] Direct transfer of eukaryotic expression plasmids from bacteria to eukaryotic hosts was first achieved several decades ago by fusion of mammalian cell protoplasts and plasmid-carrying Escherichia coli (Schaffner, 1980). Therefore, the number of bacteria capable of carrying genes to mammalian cells has increased (Weiss, 2003), being discovered by four groups independently (Siz=more et al. 1995j;. Courvalin et al., 1995;. Powell et al. , 1996; darji et al., 19) ÍÜ.
[385] [385] Shigella flexneri, attenuated Salmonella typhimuriuf' or E. coli that were generated invasively by plasmid viPuience (pWR100) of S. flexneri have been shown to be able to transfer expression plasmids following invasion of host cells and north intracellularly due to metabolic attenuation. Application in the mycosa either by nasal Pia or orally., such Sallnon recombinants (=lla jou Shigella l induced immune responses against the antigen encoded by plasmid expression. However, the list) of bacteria, demonstrated to be able to transfer expression plasmids from mammalian host cells in vitro and in vivo was more than doubled and was documented for S. typhi, S. choleraesuis, Listeria monocytogenes, Yersinia pseudotuberculosis and Y. enterocolitica (Fennelly et al., 1999; Shiau et al., 2001; Dietrich et al., 1998: Hense et al., 2001; Al-Mariri et al., 2002).
[386] [386] In general, it can be assumed that all bacteria that are capable of entering the host cell cytosol (such as S.
[387] [387] As used herein, the term "transfection", "transformation" and variations thereof are generally used interchangeably. The "transfected" or "transformed" cells may have been manipulated to introduce the polynucleotides of interest, or they may be cells derived from the progeny. recombinant cells
[388] [388] The invention also provides a recombinant cell, for example a recombinant plant cell, which is a host cell transformed with one or more polynucleotides or vectors as defined herein, or combinations thereof. The term "recombinant cell" is used interchangeably with the term "transgenic cell" herein. Suitable cells of the present invention include any cell that can be transformed with a polynucleotide vector or recombinants of the invention that encode, for example, a polypeptide or an enzyme described herein. The cell is preferably a cell capable of being used for the production of lipids. The recombinant cell can be a cell in culture, an in vitro cell, or an organism such as a plant, or an organ such as a seed or leaf.
[389] [389]The host cells into which the polynucleotides are introduced can be either untransformed cells or cells that are already transformed with at least one nucleic acid. Such nucleic acids may be related to lipid synthesis, or unrelated. The host cells of the present invention may be endogenously (i.e., naturally) capable of producing polypeptides defined herein, in which case the recombinant cell derived therefrom has a greater capacity for producing polypeptides, or may be capable of producing said polypeptides only after has been transformed with at least one polynucleotide of the invention. In one embodiment, a recombinant cell of the invention has an increased ability to produce non-polar lipid.
[390] [390] The host cells of the present invention can be any cells capable of producing at least one protein described herein, and include cells from bacteria, fungi (including yeast), parasites, arthropods, animals, algae, and cells of plants. Cells can be prokaryotic or eukaryotic. The preferred host cells are algae,
[391] [391]Host cells for the expression of instantaneous nucleic acids can include microbial hosts that grow on a wide variety of raw materials, including simple or complex carbohydrates, organic acids and alcohols and/or hydrocarbons across a wide range of values of temperature and pH. Preferred microbial hosts are oleaginous organisms, which are naturally capable of nonpolar lipid synthesis.
[392] [392]The host cells may be from an organism suitable for a fermentation process, such as, for example, Yarrowia lipolytica or other yeasts. Transgenic Plants The invention also provides a plant comprising an exogenous polynucleotide polypeptide of the present invention, a cell of the invention, a vector of the invention, or a combination thereof. The term "plant" refers to whole plants, whereas the term "part of it" refers to plant organs (eg leaves, stems, roots, flowers, fruits), individual cells (eg pollen), seeds, parts of seeds, such as an embryo, endosperm, scutellum or seed coat, plant tissue such as vascular tissue, plant cells and progeny thereof.As used herein, plant parts comprise plant cells.
[394] [394] As used here, the term "plant" is used in its broadest sense. It includes, but is not limited to, any species of grass, ornamental or decorative plant, crop or cereals (eg oilseeds, soybeans, corn), forage, fruits or vegetables, grass, woody plants, flower or tree. It is not intended to limit a plant to any particular structure. It also refers to single-celled plants (eg microalgae). The term "part thereof" in reference to a plant refers to a plant cell and the progeny thereof, a plurality of plant cells that are widely differentiated into a colony (eg, volvox), a structure in which it is present at all stages of development of a plant, or plant tissue.
[395] [395] A "transgenic plant", "genetically modified plant" or variations thereof refers to a plant that contains a transaene not found in a wild-type plant of the same species, variety, or cultivar. Transgenic plants, as defined in the context of the present invention, include plants and their progeny that have been genetically modified using recombinant techniques, to cause the production of at least one defined polypeptide in the desired plant or in part thereof. Parts of transgenic plants have a corresponding meaning.
[396] [396] The terms "serente" and "grain" are used interchangeably herein. "Grain" refers to ripe grain, such as cereal grains harvested or still in a plant, but ready for harvest, but may also refer to soaking or germinating grain, according to the. context. Ripe grain usually has a moisture content of less than about 18-20%. In a preferred embodiment, the moisture content of the grain is at a level that is generally considered safe for storage, preferably between 5% and 15%, between 6% and 8%, between 8% and 10%, or between 12% and 15%. "Developing seed" as used herein refers to a seed before maturity, typically found in the reproductive structures of the plant after fertilization or before, but can also refer to such seeds before maturity, which are isolated from a plant. Mature seed commonly has a moisture content of less than about 18-20%. In a preferred embodiment, the seed content is at a level that is generally considered safe for storage, preferably between 5 and 15%, between 6 and 8%, between 8% and 10%, or between 12% and 15%.
[397] [397] As used herein, the term "plant storage organ" refers to a part of a plant specialized for storing energy under the forin of, for example, proteins, carbohydrates, lipids. Examples of plant storage organs are fruits, seeds, tuberous roots and tubers. A preferred plant storage organ of the present invention is the seed. (398] As used herein, the term "phenotypically normal" refers to a genetically modified plant or part thereof, in particular a storage organ such as the tuber or fruit seed of the present invention not having a significantly reduced capacity for grow and reproduce when compared to an unmodified plant or part of it. In one embodiment, the genetically modified plant or part thereof. is phenotypically normal comprises a recombinant polynucleotide encoding a silencing suppressor operably linked to a plant storage organ specific promoter and has an ability to grow or reproduce which is essentially the same as the corresponding plant or part thereof not comprising the said polynucleotide. Preferably, the biomass, growth rate, germination rate, storage organ size, seed size and/or number of viable seeds produced is not less than 90° of that of a plant deficient in said recombinant polynucleotide, when grown under identical conditions. This term does not encompass plant characteristics. which may be different for the wild-type plant, but do not affect the utility of the plant for commercial purposes, such as a ballerina phenotype of seedling leaves.
[399] [399].Plants provided or contemplated for use in the practice of the present invention include both monocots and dicots. In a preferred embodiment, the plants of the present invention are crop plants (e.g., cereals and legumes, corn, wheat, potato, tapioca, rice, corn, sorghum, cassava, barley, or pea), or other legumes. Plants can be cultivated for the production of roots, edible tubers, leaves, caules, flowers or fruits. Plants can be vegetables or ornamental plants. The plants of the present invention can be: Acrocomia aculeata (macaúba palm), Arabidopsis thaliana, Aracinis hypogaea (peanut), Astrocaryum murumuru (rnurumuru), The exchange ryum vulgare (tucumã), Attalea geraensis (Indaiá-rateiro), (Attalea humuris), American oil palm), Attalea oleifera (scaffold), Attalea phalera ta (uricuri), Attalea speciosa (babaçu), Avena sativa (oats), Beta vulgaris (beet), Brassica sp. such as Brassica carinata, Brassica juncea, Brassica napobrassica, Brassica napus (canola), Camelina sativa (false linen), Cannabis sativa (hemp), Carthamus tinctorius (safflower), Caryccar brasiliense (pequi) , Cccos nucifera (CcOCO) abyssinica (Abyssinian kale), Cucumis melo (melon), Elaeis guineensis (African palm), Glycine max (soybean), Gossypium hirsutum (cotton), Helianthus sp.
[400] [400] Other preferred plants include C4 grasses, corium, in addition to those mentioned above, Andropogon geradi, Bouteloua curtipendula, B. gracilis, Buchloe dactyloides, Schizachyrium scoparium, Sorghastrum nutans, Sporobolus cryptandrus; C3 grasses, such as Elymus canadensis, the vegetables Lespedeza capitata and Petalostemum villosum, the forb Aster azureus, and woody plants such as Quercus ellipsoidalis and Q. macrocarpa. Other preferred plants include C3 grasses.
[401] [401] In a preferred embodiment, the plant is an angiosperm.
[402] [402] In one embodiment, the plant is an oil seed plant, preferably an oil plant. As used herein, an "oil plant" is a species of plant used in the commercial production of lipid from the seeds of the plant. The oilseed plant, for example, can be oil from rapeseed (eg rapeseed), corn, sunflower, saffron, soybean, sorghum, flax (linseed) or sugar beet. In addition, the oil plant can be other Brassicas, cotton, peanuts, poppy, rutabaga, mustard, castor bean, sesame, saffron, walnut or producing plants. The plant can produce high levels of lipids in its fruit, such as olive oil, palm oil or coconut. Horticultural plants to which the present invention can be applied are lettuce, Brassicas endive, or vegetable, including cabbage, broccoli or cauliflower. The present invention can be applied to tobacco, cucurbits, carrots, strawberries, tomatoes or peppers.
[403] [403] In a preferred embodiment, the transgenic plant is homozygous for each and every gene that has been introduced (transgene), so that its offspring do not segregate to the desired phenotype. the transgenic plant may also be heterozygous for the introduced transgene, preferably uniformly heterozygous for the transgene, as, for example, in the F1 progeny that were grown from hybrid seeds. Such plants can provide advantages, such as hybrid vigor, well known in the art.
[404] [404] When relevant, transgenic plants can also
[405] [405] Transgenic plants can be produced using techniques known in the art, such as those generally described in Slater et al., Plant Biotechnology - The Genetic Manipulation of Plants, Oxford University Press (2003), and Christou and Klee, Handbook of Plant Biotechnology , John Wiley and Sons (2004).
[406] [406] As used herein, the terms "stably transform", "stably transformed" and variations thereof refer to the integration of the polynucleotide into the cell's genome such that they are transferred to the descendant cells during cell division, without the need for positive selection for its presence. Stable-form transformants, or their descendants, can be selected by any means known in the art, such as Southern blots of chromosomal DNA, or in situ hybridization of genomic DNA.
[407] [407]Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because DNA can be introduced into cells in whole plant tissues, plant organs, or explants' in tissue culture, or for expression transient or for the stable integration of DNA into the plant cell genome. The use of Agrobacterium-mediated plants for introducing DNA integrating vectors into plant cells is well known in the art (see, for example, US 5177010, US 5104310, US 5004863, or US 5159135). The region of DNA to be transferred is defined by the boundary sequences, and the intervening DNA (T-DNA) is usually inserted into the plant genome. Furthermore, T-DNA integration is a relatively precise process resulting in few rearrangements. In those plant varieties where Agrobacterium-mediated transformation is efficient, this is the method of choice due to the easy and defined nature of the transfer gene. Preferred Agrobacterium transformation vectors are capable of replication in E. coli as well as in Agrobacterium, allowing convenient manipulations as described (Klee et al., In: Plant DNA Infections Agents, Hohn and Schell, eds, Springer-Verlag, New York, pp 179-203 (1985)).
[408] [408]Acceleration methods that may be used include, for example, bombing of microprojectiles, etc. An example of a method for delivering transformed nucleic acid molecules into plant cells is microprojectile bombardment. This method has been reviewed by Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994). Non-biological particles (microprojectiles) that can be coated with nucleic acids and released into cells by a force of propulsion. Examples of particles include those composed of tungsten, gold, platinum, and the like. A particular advantage of microprojectile bombing, besides the fact that it is an efficient and reproducible means of transforming monocots, is neither isolation of protoplasts nor susceptibility to infection by Agrobacterium is necessary. An illustrative embodiment of a method for releasing DNA into Zea mays cells by acceleration is a biolistics a-particle release system, which can be used to propel DNA-coated particles through a screen such as stainless steel or Nytex screen, for a filter surface covered with suspension grown corn cells. A suitable particle delivery system for use with the present invention is the PDS-1000/He helium accelerating weapon available from 81o-Rad Laboratories.
[409] [409] For bombardment, cells in suspension can be concentrated on filters. Filters containing the cells to be bombarded are positioned at an appropriate distance below the microprojectile stop plate. If desired, one or more screens are also placed between the weapon and the cells to be bombed.
[410] [410] Alternatively, immature embryos or other target cells can be arranged in solid culture media. The cells to be bombarded are positioned at an appropriate distance below the microprojectile stop plate. If desired, one or more screens are also placed between the acceleration device and the cells to be bombarded. Through the use of established techniques in the present invention, up to 1000 or more cell foci can be obtained transiently expressing a marker gene. The number of cells in a foci that express the gene product 48 hours after bombardment often ranges from one to ten and averages one to three.
[411] [411] In bombing transformation, one can optimize prebomb culture conditions and bombing parameters to give maximum numbers of stable transformants. Both physical and biological parameters for bombing are important in this technology. Physical factors are those that involve the manipulation of the precipitated/microprojectile DNA or those that affect the flight and speed of either the macro or microprojectiles. Biological factors include all the steps involved in manipulating cells before and immediately after bombardment, osmotic adjustment of target cells to help alleviate trauma associated with bombardment, and also the nature of transforming DNA such as linearized DNA or plasmids supercoiled intact. Pre-bomb manipulations are believed to be especially important for the successful transformation of immature embryos.
[412] [412] In another alternative embodiment, plastids may be stably transformed. Disclosed methods for transforming plastids in higher plants include the release of DNA particles containing a weapon selection marker and targeting the DNA to the plastid genome through homologous recombination (US 5,451,513, US 5,545,818, US
[413] [413]Thus, it is contemplated that one may wish to adjust the various aspects of the bombardment parameters in small-scale studies to fully optimize the conditions. One may particularly wish to adjust physical parameters such as spacing distance, flight distance, tissue distance and helium pressure. It is also possible to minimize the trauma reduction factors, modifying the conditions that influence the physiological state of the receptor cells and that can, therefore, influence the transformation and integration efficiency. For example, the osmotic state, tissue hydration and subculture phase or cell cycle of recipient cells can be adjusted for optimal transformation. Performing other routine adjustments will be known to those skilled in the art in light of the present disclosure.
[414] [414] Plant protoplast transformation can be accomplished using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments. The application of these systems to different plant varieties depends on the ability to regenerate the particular plant lineage from protoplasts. Illustrative methods for regenerating cereals from protoplasts are described (Fujimura et al., 1985; Toriyama et al., 1986; Abdullah et al., 1986).
[415] [415]Other cell transformation methods can also be used and include, among others, introducing DNA into plants by direct DNA transfer into pollen, by direct injection of DNA into a plant's reproductive organs, or by direct injection of DNA within cells of immature embryos derived from rehydration of desiccated embryos.
[416] [416] The regeneration, development, and cultivation of plants from single plant transforming protoplasts or from various transforming explants is well known in the art {Weissbach et al., In: Methods for Plant Molecular Biology, Academic Press , San Diego, Calif, (1988)). This process of regeneration and growth typically includes the steps of selecting the transformed cells, culturing those individualized cells through the usual stages of embryonic development to the rooted seedling stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are then planted in an appropriate plant growth medium such as soil.
[417] [417] The development or regeneration of plants containing the gene, gene and exogenous gene is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from regenerated plants is crossed with plants grown from seeds of agronomically important lineages. On the other hand, plant pollen from these important strains is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired polynucleotide is cultivated using methods well known to one of skill in the art.
[418] [418] Methods for transforming dicots, primarily through the use of Agrobacterium tumefaciens, and obtaining transgenic plants have been published for cotton (US 5,004,863, US 5,159,135, US 5,518,908), soybean (US 5,569 .834, US 5,416,011), Brassica (US 5,463,174), peanuts (Cheng et al., 1996), and peas (Grant et al., 1995).
[419] [419] Methods for transforming cereal plants, such as wheat and barley, for introducing genetic variations into the plant through the introduction of an exogenous nucleic acid, and for regenerating plants from protoplasts or from immature embryos of plants are well known in the art see, for example, CA 2,092,588, AU 61781/94, AU 667939, US 6,100,447, WO 97/048814, US 5,589,617, US 6,541,257, and other methods are set forth in WO 99/14314. Preferably, transgenic wheat or barley plants are produced by Agrobacterium tumefaciens-mediated transformation procedures. Vectors carrying the desired polynucleotide can be introduced into wheat plant cells regenerating from cultivated plant tissues or explants, or suitable plant systems such as protoplasts.
[420] [420] Regenerable wheat cells are preferentially from the scutellum of immature embryos, mature embryos and calluses derived therefrom, or from meristematic tissue.
[421] [421] To confirm the presence of the transgenes in transgenic cells and plants, a polymerase chain reaction (PCR) or Southern blot analysis can be performed using methods known to those skilled in the art. Transgene expression products can be detected in any of a variety of ways, depending on the nature of the product and include Western blot and enzymatic assays. A particularly useful way to quantify protein expression and to detect replication in different plant tissues is to use a reporter gene such as GUS. Once transgenic plants have been obtained, they can be cultivated to produce tissues or plant parts that have the desired phenotype. Plant tissue or plant parts can be harvested and/or seed harvested. The seed can serve as a source for the growth of additional plants with tissues or parts having the desired characteristics. Preferably, vegetative plant parts are collected at a time when nonpolar lipid yields are highest. In one modality, the vegetative plant parts are collected close to the flowering time.
[422] [422] A transgenic plant formed using Agrobacterium or other transformation methods typically contains a single genetic locus on a chromosome. Such transgenic plants can be referred to as being hemizygous for the added gene. Most preferred is a transgenic plant that is homozygous for the added gene, that is, a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of the chromosome pair. A homozygous transgenic plant can be obtained by self-fertilizing a hemizygous transgenic plant, germinating some of the seeds produced and analyzing the resulting plants for the gene of interest.
[423] [423] It should also be understood that two different transgenic plants that contain two independently segregating exogenous genes or loci may also be crossed (coupled) to produce offspring that contain both sets of genes or loci. Self-fertilization of appropriate F1 progeny can produce plants that are homozygous for the exogenous genes or loci. Backcrossing to a parent plant and crossing to a non-GM plant are also contemplated, as is vegetative propagation. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in Fehr, In: Breeding Methods for Cultivar Development, Wilcox J. ed., American Society of Agronomy, Madison Wis. (1987). TILLING
[424] [424] In a modality TILLING (Targeting Induced Local Lesions IN Genomes) can be used to produce where endogenous genes are suppressed, eg, genes encoding a DGAT, sn-l-glycerol- 3-phosphate acyltransferase (GPAT), 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT), acyl-CoA: lysophosphatidylcholine acyltransferase (LPCAT), phosphatidic acid phosphatase (PAP), or a combination of two or more of these.
[425] [425] In a first step, introduced mutations such as changes to a single new base pair are induced in a plant population by treating seeds (or pollen) with a chemical mutagenic agent, and then proceeding to a generation of plants, where mutations will be stably inherited. DNA is extracted, and seeds are stored from all members of the population to create a resource that can be accessed repeatedly over time.
[426] [426] For a TILLING assay, PCR primers were designed to specifically amplify a single target gene of interest. Specificity is particularly important if the target is a member of a gene family, or part of a polyploid genome. Then, dye-labeled primers can be used to amplify the PCR products from a pool of DNA from multiple individuals. These PCR products were denatured and reannealed to allow the formation of mismatched base pairs. Deserr.pairing or heteroduplexes represents both naturally occurring single nucleotide polymorphisms (SNPs) (ie, multiple plants in the population are likely to carry the same polymorphism) and SNP-induced polymorphism (ie, only rare individual plants are likely to carry the same polymorphism) to display the mutation). After heteroduplex formation, the use of an endonuclease such as Cell,
[427] [427]Using this approach, innumerable thousands of plants can be screened to identify any individual with a single base change, as well as small insertions or deletions (1-30 bp) in any specific gene or region of the genome. Analyzed genomic fragments can vary in size, anywhere from 0.3 to 1.6 kb. Clusters in eight times, 1.4 kb fragments (discounting the ends of fragments where SNP detection is problematic due to noise) and 96 wells per assay, this combination allows for up to one million base pairs of DNA genomic are tracked by a single assay, making TILLING a high-throughput technique. TILLING is further described in .Knauf and Slade (2005), and Henikoff et al. (2004).
[428] [428]In addition to enabling efficient mutation detection, high-throughput TILLING technology is ideal for detecting natural polymorphisms. Therefore, interrogating an unknown homologous DNA by heteroduplexing to a known sequence reveals the number and position of polymorphic sites. Both nucleotide changes and small insertions and deletions are identified, including at least some number of repeated polymorphisms. This has been called Ecotilling (Comai et al., 2004).
[429] [429] Each SNP is recorded by its approximate position between a few nucleotides. Thus, each haplotype can be archived based on its mobility. Sequence data can be obtained with relatively little additional effort using aliquots of the same amplified DNA that is used for mismatch cleavage assay. The left or right primer for an individual sequencing reaction is chosen for its proximity to the polymorphism. f3oftware Sequencher performs a multiple alignment and finds the base shift, which in each case confirmed the band on the gel. '
[430] [430] Ecotilling can be performed cheaper than full sequencing, the method currently used for most SNP discoveries. Plaques containing ecotypic DNA arrays can be screened in place of DNA pools from mutagenized plants. As detection is in gels with base pair resolution and background patterns are uniform across bands, bands that are of identical size can be combined, thus discovering SNPS genotyping in a single step. Thus, the final sequencing of the SNP is simple and efficient, even more accentuated by the fact that aliquots of the same PCR products used for screening can be submitted to DNA sequencing.
[431] [431] Post-transcriptional gene silencing (P'I'GS) is a nucleotide sequence-specific defense mechanism that can target both viral and cellular mRNAs for degradation. PTGS occurs in plants or fungi stably or transiently transformed with a recombinant polynucleotide and results in reduced accumulation of RNA molecules with similar sequence age to the introduced polynucleotide. "Posttranscriptional" refers to a mechanism operating at least partially, but not necessarily exclusively, after the production of an initial RNA transcript, for example during processing of the initial RNA transcript, or concomitant with RNA splicing or export to the cytoplasm, or within the cytoplasm by complexes associated with Argonauta proteins.
[433] [433] As used herein, the term "stably expressed" or variations thereof refers to the level of the RNA molecule that is essentially the same or higher in repeated generations in plant progenesis, eg, at least three, at least five, or at least ten generations, when compared to corresponding plants lacking the exogenous polynucleotide encoding the silencing suppressor. However, this term does not exclude the possibility that over repeated generations there is some loss of RNA molecule levels when compared to a previous generation, eg not less than 10% loss per generation.
[434] [434] The suppressor can be selected from any source, eg plant, viral, mammal, etc. The suppressor can be, for example, flock house virus B2, latent pothos virus P14, latent pothos virus AC2, African cassava mosaic virus AC4, bhendi yellow vein mosaic disease C2, bhendi yellow vein mosaic disease C4 , bhendi yellow vein mosaic disease j3cl, tomato chlorosis virus p22, tomato chlorosis virus CP, tomato chlorosis virus CPm, tomato golden mosaic virus AL2, tomato curved leaf java virus j3c1, virus tomato yellow curve leaf 1 virus V2, tomato yellow curve leaf virus C2, isolated j3c1 tomato yellow curve leaf China virus YlO,
[435] [435] Mute suppressors can be categorized based on their modes of action. Suppressors like V2 that preferentially bind a double-stranded RNA molecule that has 5' overhanging ends to a corresponding double-stranded RNA molecule having blunt ends are particularly useful for improving transgene expression when used in combination with gene silencing ( exogenous polynucleotide encoding a CISRNA). Other suppressors such as p19 that preferentially bind a dsRNA molecule that is 21 base pairs in length relative to a dsRNA molecule of a different length may still allow transgene expression in the presence of an exogenous polynucleotide encoding a CISRNA, but usually in a degree less than, for example, V2. This allows selection of an optimal combination of dsRNA, silencing suppressor and overexpressed transgene for a particular purpose. Said ideal combinations can be identified using a method of the invention.
[436] [436] In one embodiment, the silencing suppressor preferentially binds to a double-stranded RNA molecule that has 5' overhanging ends relative to a corresponding double-stranded RNA molecule having blunt ends. In this context, the corresponding double-stranded RNA molecule preferably has the same nucleotide sequence as the molecule with the 5' overhanging ends, but without the 5' overhanging ends. Binding assays are routinely performed, for example, in vitro assays, by any method known to one skilled in the art.
[437] [437]Multiple copies of a power suppressor. be used. The different suppressors can be used together (eg in tandem).
[438] [438] Essentially any RNA molecule that is desirable to be expressed in a plant storage organ can be co-expressed with the silencing suppressor. The RNA molecule can influence an agronomic trait, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and the like. Encoded polypeptides may be involved in the metabolism of lipids, starch, carbohydrates, nutrients, etc., or may be responsible for the synthesis of proteins, oepeptides, lipids, waxes, starches, sugars, carbohydrates, flavors, odors, toxins, carotenoids, hormones , polymers, flavonoids, storage proteins, phenolic acids, alkaloids, lignins, tannins, cellulose, glycoproteins, glycolipids, etc.
[439] [439] In one specific example, plants produced increased levels of lipid-producing enzymes in plants such as cabbage, rapeseed or sunflower, cotton, flax, safflower, soybean, or corn. plant biomass
[440] [440] An increase in the total lipid content of plant biomass equates to increasing the energy content making its use in biofuel production more economical.
[441] [441] Plant biomass is organic material produced by plants, such as leaves, roots, seeds, and stalks. Plant biomass is a complex mixture of organic materials such as carbohydrates, fats and proteins along with small amounts of minerals such as sodium, phosphorus, calcium and iron. The main components of plant biomass are carbohydrates (approximately 75%, dry weight) and lignin (approximately 25%), which can vary with plant type. Carbohydrates are mainly cellulose fibers or hemicellulose, which provide strength to the plant's structure, and lignin, which holds the fibers together. Some plants also store starch (another carbohydrate polymer) and fats as energy sources,
[442] [442] Plant biomass typically has an energy density as a result of both its physical form and moisture content. This makes it inconvenient and inefficient for storage and transport, and also generally not suitable for use without some form of pre-processing.
[443] [443] There is a range of processes available to convert this in a more convenient way including: 1) physical pre-processing (eg milling) or 2) conversion by thermal (eg combustion, gasification, pyrolysis) or chemical processes (eg anaerobic digestion, fermentation, composting, transesterification). In this way, biomass is converted into what can be described as a biomass fuel. Combustion [Ll44]Combustion is the process by which flammable materials are allowed to burn in the presence of air or oxygen with the release of heat. The basic process is oxidation. Combustion is the simplest method by which biomass can be used for energy, and it was used to provide heat. This heat can itself be used in a number of ways: 1) space heating, 2) water (or other fluid) heating for central or district heating or process heat, 3) yapor production for electricity generation or driving force. When flammable combustible material is a form of biomass, oxidation is predominantly carbon (C) and hydrogen (H) in - cellulose, hemicellulose, lignin, and other molecules present to form carbon dioxide (CO2) and water (H2O). Gasification
[445] [445] Gasification is a partial oxidation process whereby a carbon source such as plant biomass is broken down into carbon monoxide (CO) and hydrogen (H2), plus carbon dioxide (CO2) and possibly hydrocarbon molecules such as methane ( CH4). If gasification takes place at a relatively low temperature, such as 700°C to 1000°C, the product gas will have a relatively high level of hydrocarbons compared to high temperature gasification. As a result, it can be used directly, to be burned for heat or electricity generation through a steam turbine or with appropriate gas cleaning, to run an internal combustion engine for electricity generation. The combustion chamber for a simple boiler can be closely coupled with the gasifier, or the producer gas can be cleaned of higher chain hydrocarbons (tars), transported, stored and re-ignited. A gasification system can be closely integrated with a combined cycle gas turbine for electricity generation (IGCC - integrated gasification combined cycle). Higher temperature gasification (1200°C to 1600°C) leads to fewer hydrocarbons in the product gas, and a higher proportion of CO and H2.
[446] [446] As used herein, the term "pyrolysis" means a process that uses slow heating in the absence of oxygen to produce gaseous, oily, and charcoal products from biomass.
[447] [447]Pyrolysis involves thermal cracking of lipids or a combination of thermal and catalytic cracking. At temperatures of about 400-500°C, cracking occurs, producing short-chain hydrocarbons such as alkanes, alkenes, alkadienes, aromatics, olefins and carboxylic acid, as well as carbon monoxide and carbon dioxide. ) i
[448] [448] Four types of principal catalysts include
[449] [449] "Transesterification" as used herein is the conversion of lipids, primarily triacylglycerols, to fatty acid methyl esters or ethyl esters using short-chain alcohols such as methanol or ethanol, in the presence of a catalyst such as alkalis or acids. Methanol is most commonly used due to its low cost and availability. Catalysts can be homogeneous catalysts, heterogeneous catalysts or enzymatic catalysts. Homogeneous catalysts include ferric sulfate followed by KOH. Heterogeneous catalysts include CaO, K3PO4, and WO3/ZrO2. Enzyme catalysts include Novozyme 435 Produced from Candida antarctica. a.naerobic digestion
[450] [450] Anaerobic digestion is the process by which bacteria break down organic material in the absence of air, generating a biogas containing methane. The products of this process are biogas (mainly methane (CHJ and carbon dioxide (CO2)), a solid residue (fiber or digestate) that is similar to, but not identical to, the compost, and a liquid liquor that can be used as a fertilizer. Methane can be burned to generate heat or electricity. The solid residue from the anaerobic digestion process can be used as a solid conditioner or alternatively it can be combusted as a fuel or gassed.
[451] [451] Anaerobic digestion is typically performed on biological material in an aqueous slurry. However, there is urr'. increasing number of dry digesters. R'aesophilic digestion takes place between 20°C and 40°C and may take a month or two to complete. Thermophilic digestion occurs at 50-65°C and is rapid inafs, but bacteria are more sensitive.
[452] [452]Conveltional fermentation processes for the production of bioalcohol make use of compounds J, starch and sugar from plant crops. Second generation bioalcohol does this with acidic and/or enzymatic hydrolysis of hemicellulose and cellulose into fermentable saccharides to make use of a greater proportion of available biomass. More detail is provided under the heading "Lipid Production Fermentation Processes". compost
[453] [453] Composting is the aerobic decomposition of organic matter by microorganisms. It is typically performed on relatively dry material other than a paste. Instead of, or in addition to, collecting the flammable biogas emitted, the exothermic nature of the composting process can be explored and the heat produced used, usually using a heat pump. Apolar Lipid Production
[454] [454] Techniques that are routinely practiced in the art can be used to extract, process, purify and analyze nonpolar lipids produced by cells, organisms or parts thereof in the present invention. Such techniques are described and explained throughout the literature in sources such as Fereidoon Shahidi, Current Protocols in Food Analytical Chemistry, John Wiley & Sons, Inc. (2001) D1.1.1-D1.1.11, and Perez-Vich et al. (1998). Seed Oil Production
[455] [455]Normally, plant seeds are cooked, pressed, and/or extracted to produce crude seed oil, which is then degummed, refined, bleached, and deodorized. Generally, techniques for squashing sernants are known in the art. For example, seed oils can be tempered by spraying them with water to increase the moisture content eg 8.5% and flaked using a smooth roller with a gap setting of 0.23 to 0.27 mm . Depending on the type of seed, water cannot be added before crushing.
[456] [456] In one embodiment, most of the seed oil is released by passing it through a screw press. Pies expelled from the screw press are then extracted with solvents, eg hexane, using a heat-traced column.
[457] [457] Once the solvent is removed from the crude seed oil, the pressed and extracted parts are combined and subjected to normal lipid processing procedures (ie, degumming, caustic refining, bleaching and deodorizing).
[458] [458] In one embodiment, the oil and/or protein content of the seed is analyzed by infrared reflectance spectroscopy as described in Hom et al. (2007).
[459] [459]Degumming is an early step in oil refining and its primary purpose is to remove most of the phospholipids from the oil, which may be present as approximately 1-2% of the total extracted lipid. Addition of -2% water, typically containing phosphoric acid, at 70-80°C to the crude oil results in the separation of most of the phospholipids" accompanied by trace metals and pigments. The insoluble material that is removed is primarily a mixture of phospholipids and triacylglycerols and is known as a lectin. Degumming can be accomplished by adding concentrated phosphoric acid to crude seed oil to convert unhydrated phosphatides to hydrated form and to chelate minor metals that are present. The gum is separated from the seed oil by centrifugation The seed oil can be refined by adding a sufficient amount of a sodium hydroxide solution to titrate all the acids.
[460] [460]Alkaline refining is one of the refining processes for treating crude oil, sometimes referred to as neutralization. This usually follows degumming and bleaching. After degumming, the seed oil can be treated by adding a sufficient amount of an alkaline solution to titrate all the fatty acids and phosphoric acids and removing the soaps thus formed. Suitable alkaline materials include sodium hydroxide, potassium hydroxide, sodium carbonate, lithium hydroxide, calcium hydroxide, calcium carbonate and ammonium hydroxide. This process is typically carried out at room temperature and removes the free fatty acid fraction. Soap is removed by centrifugation or extraction in a soap solvent, and the neutralized oil is washed off with water. If required, any excess alkaline in the oil can be neutralized with an appropriate acid such as hydrochloric acid or sulfuric acid.
[461] [461]Bleaching is a refining process in which oils are heated to 90-120°C for 10-30 minutes in the presence of a bleaching earth (0.2-2.0%) and in the absence of oxygen by operating with nitrogen or steam in a vacuum. This step in oil processing is designed to remove unwanted pigments (carotenoids, chlorophyll, gossypol etc), and the process removes oxidation products, trace metals, sulfur compounds and soap traces.
[462] [462]Winterization is a process occasionally used in commercial oil production for the separation of oils and fats into solid (stearin) and liquid (olein) fractions by crystallizing at sub-ambient temperatures. This was originally applied to cottonseed oil to produce a solid free product. This Dara is typically used to reduce the saturated fatty acid content of oils. Plant biomass for lipid production
[463] [463] Plant parts involved in photosynthesis (eg, stems and leaves from higher plants and from aquatic plants such as algae) can also be used to produce lipids. Regardless of the type of plant, there are several methods for extracting lipids from green biomass. One way is physical extraction, which often does not use solvent extraction. Yeah, a "traditional" way using several different types of mechanical extraction. Pressurized bagasse is a common type, as are screw press extraction and ram press extraction methods. The amount of cle. The lipids extracted using these methods vary widely depending on the plant material and the mechanical process employed. Mechanical extraction is typically less efficient than solvent extraction!
[464] [464]In solvent extraction, an organic solvent (eg hexane) is mixed with at least the genetically modified green biomass of the plant, preferably after the green biomass is dried and ground. Naturally, other plant parts besides green biomass (eg seeds that contain lipids) can be ground and mixed as well. The solvent dissolves the lipids in the biomass and the like, which solution is then separated from the biomass by mechanical action (eg with the pressing processes above). This separation step can also be carried out by filtration (eg with a filter press or knurling device) or centrifugation etc. The organic solvent can then be separated from the non-polar lipid (eg by distillation). This second separation step produces nonpolar lipids from the plant and can produce a reusable solvent if employing conventional vapor recovery.
[465] [465] If, for example, vegetative tissue as described here is not used immediately to extract, and/or process, the lipid is preferably manipulated after harvesting to ensure that the lipid content does not reduce, OLl so that any increase in lipid content is minimized as much as possible (see, for example, Christie, 1993). In one embodiment, vegetative tissue is frozen as soon as possible after harvesting using, for example, dry ice or liquid nitrogen. In another embodiment, the vegetative tissue is stored at a cool temperature, eg -20°C or -60°C in a nitrogen atmosphere.
[466] [466] Algae can produce 10 to 100 times as much mass as land plants in a year. In addition to being a prolific organism, tall ones are also capable of producing oils and starches that can be converted into biofuels.
[467] [467]The specific algae most useful for biofuel production are known as microalgae, consisting of small types that are generally unicellular. These algae can grow almost anywhere. With over 100,000 known species of diatoms (a type of algae), 40,000 known species of tall green plant types, and smaller numbers of other algae species, algae will grow rapidly in almost any environment, with almost any type of water. Specifically, useful algae can be grown in marginal areas with limited water or poor quality, such as in the arid and mostly empty regions of the American Southwest. These areas still have plenty of sunlight for photosynthesis. In summary, algae can be an ideal organism for the production of biofuels - efficient growth, not precisely special land or water, not competing with food crops, requiring very small amounts of land than food crops, and storing energy in a desirable way.
[468] [468] Algae can store energy in their cellular structure in the form of oil or starch. Stored oil can be as much as 60% of the weight of the seaweed. Certain species that are highly prolific in oil or starch production were identified and growing conditions tested. Processes for extracting and converting these materials into fuels have been further developed.
[469] [469] The most common high oil yields can generally include, or consist of, diatoms (bacillaryophytes), green algae (chlorophytes), blue-green alaa (cyanophytes), and golden-brown algae (chrysophytes). In addition, a fifth group known as haptophytes can be used. Groups include brown algae and heterokonts. Specific non-limiting examples of algae include the Classes: Chlorophyceae, Eustigmatophyceae, Prymnesiophyceae, Bacillariophyceae. Bacillariophytes capable of producing oil include the genera Amphipleura, Amphora, Chaetoceros, Cyclotella, Cymbella,
[470] [470] Specific algae useful in the present invention include, for example, Chlamydomonas sp. such as Chlamydomonas reinhardtii, Dunaliella sp. such as Dunaliella salina, Dunaliella tertiolecta, D. aciâophila, D. bardawil, D. bioculata, D. lateralis, D. maritima, D. minuta, D. parva, D. peircei, D. polymorpha, D. primolecta, D. pseudosalina , D. Quartolecta. D. viridis, Haematococcus sp., Chlorella sp. such as Chlorella vulgaris, Chlorella sorokiniana or Chlorella protothecoides, Thraustochytrium sp., Schizochytrium sp., Volvox sp, Nannochloropsis sp., Botryococcus braunii which may contain more than 60% by weight of lipids, Phaeodactylum sp. sp., Chlorococcum sp., Ellipsoidion sp., Neochloris sp., Scenedesmus sp.
[471] [471] Other oil-producing algae of the present invention may include a combination of an effective amount of two or more strains to maximize the benefits of each strain. As a practical matter, it can be difficult to get 100% purity of a single algae strain or a combination of desired algae strains. However, when discussed here, oil-producing algae are intended to cover intentionally introduced strains of algae, while extraneous strains are preferably minimized and kept below an amount that would detrimentally affect yields of desired oil- and oil-producing algae of seaweed. Strains of unwanted algae can be controlled and/or mined using any number of techniques. For example, careful control of the growing environment can reduce the introduction of foreign strains. Alternatively or in addition to other techniques, a virus selectively chosen to specifically target only the foreign strains can be introduced into the growth reservoirs in an amount that is effective to reduce and/or eliminate the foreign strain. An appropriate virus can be readily identified using conventional techniques. For example, a foreign algae sample will most often include small amounts of a virus that targets the foreign algae. This virus could be isolated and grown to produce small amounts that could effectively control or eliminate the alien algae population among the most desirable oil-producing algae.
[472] [472]Algaculture is a form of aquaculture involving the cultivation of algae species (including microalgae, also known as phytoplankton, microphytes, or planktonic algae and macroalgae, commonly known as algae).
[473] [473] Commercial and industrial algae cultivation has numerous uses, including the production of algae food, food and fuel ingredients.
[474] [474] Algae monocultures or mixed cultures can be grown in open ponds (as a raceway type, ponds and lakes) or in photobiorectors. 0
[475] [475] Algae can be harvested using microscreens, by centrifugation, by flocculation (using, for example, chitosan, alum and ferric chloride) and by flotation. Disrupting the supply of carbon dioxide can cause algal flocculation by itself, which is called "autoflocculation". In flotation, the grower airs the water into a foam, and then slides the algae foam from the top. Ultrasound and other harvesting methods are currently under development. {476] Lipids can be separated from algae by mechanical crushing. When algae are dried they retain their lipid content, which can then be "pressed" out with an oil press. Since different strains of algae vary greatly in their physical attributes, different press configurations (screw, piston bagasse, etc.) work best for some types of algae.
[477] [477] Osmotic shock is sometimes used to release cellular components such as lipids from algae. Osmotic shock is the sudden reduction in osmotic pressure and can cause cells to rupture in solution. [478jUltrasonic extraction can accelerate extraction processes, in particular the enzymatic extraction processes used to extract lipids from algae. Ultrasonic waves are used to create cavitation bubbles in the solvent material. When these bubbles collapse near the cell walls, the resulting shock waves and jets of liquid cause the cell walls to burst and release their contents into a solvent.
[479] [479] Chemical solvents (eg, hexane, benzene, petroleum ether) are often used in the extraction of lipids from algae. Soxhlet extraction can be used to extract lipids from algae by repeated washing, or percolation, with an organic solvent under reflux in special glassware.
[480] [480] Enzymatic extraction can be used to extract lipids from algae. Enzymatic extraction uses enzymes to degrade cell walls with water acting as a solvent. Enzymatic extraction can be supported by ultrasonication.
[481] [481] Supercritical CO2 can also be used as a solvent. In this method, CO2 is liquefied under pressure and heated to the point where it becomes supercritical (which will have properties of both a liquid and a gas), letting it act as a solvent. Fermentation processes for lipid production
[482] [482] As used herein, the term "fermentation process" refers to any fermentation process, or any process comprising a fermentation step. A fermentation process includes, among others, the fermentation processes used for the production of alcohols (eg ethanol, butanol, methanol), organic acids (eg citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid ), ketones (eg acetone), amino acids (eg glutamic acid), gases (eg H2 and CÕ2), antibiotics (eg penicillin and tetracycline), enzymes, vitamins (eg riboflavin, beta -carotene), and hormones. Fermentation processes also include fermentation processes used in the consumer alcohol industry (eg beer and wine), dairy industry (eg fermented dairy products), the leather industry and the tobacco industry. Preferred fermentation processes include alcohol fermentation processes as are well known in the art. Preferred fermentation processes are anaerobic fermentation processes as are well known in the art.
[483] [483] Examples of microorganisms include fungal yeast organisms such as yeast, preferably an oleaginous organism. As used herein, an "oil organism" is one that accumulates at least 25% of its dry weight as triglycerides. As used herein, "yeast" includes Saccharomyces spp., Saccharomyces cerevisiae, Saccharomyces carlbergensis, Candida spp., Kluveromyces spp., Pichia spp., Hansenula spp., Trichoderma spp., Lipomyces Starly, and Yarrowia. Preferred yeasts include Yarrow-ia lipolytica or other oleaginous yeasts and strains of Saccharomyces spp.
[484] [484] In one embodiment, the fermentation microorganism is a transgenic organism comprising one or more exogenous polynucleotides, where the transgenic organism has an increased level of one or more nonpolar lipids when compared to a corresponding organism lacking one or more exogenous polynucleotides. The transgenic microorganism is preferably cultivated under conditions that optimize the activity of fatty acid bisynthesis genes and fatty acid acyltransferase genes. This leads to the highest yield and most economical production of lipids. In general, media conditions that can be optimized include the type and amount of carbon source, the type and amount of nitrogen source, the carbon-nitrogen ratio, the oxygen level, the growth temperature, pH, duration of the biomass production phase, duration of the lipid accumulation phase and the time of cell harvesting.
[485] [485]Means for fermenting must contain a suitable carbon source. Carbon sources may include, but are not limited to: monosaccharides (eg, glucose, fructose), disaccharides (eg, lactose, sucrose), oligosaccharides, polysaccharides (eg, starch, cellulose or mixtures thereof), sugar alcohols ( eg glycerol) or mixtures of renewable raw materials (eg permeated whey, corn liqueur, beet molasses, barley malt). In addition, carbon sources can include alkanes, fatty acids, fatty acid esters, monoglycerides, diglycerides, triglycerides, phospholipids and various commercial sources of fatty acids, including vegetable oils (eg Soybean oil) and animal fats . In addition, the carbon substrate may include a carbon substrate (eg, carbon dioxide, methanol, formaldehyde, formate, carbon-containing amines) for which metabolic conversion to key biochemical intermediates has been demonstrated. Thus, it is contemplated that the carbon source used in the present invention may encompass a wide variety of carbon-containing substrates and will only be limited by the choice of host microorganism. Although all of the above mentioned carbon substrates and mixtures thereof are expected to be suitable in the present invention, preferred carbon substrates are sugars and/or fatty acids. Most preferred is glucose and/or fatty acids containing between 10-22 carbons. Nitrogen can be supplied from an inorganic (eg (NH4)2SO4) or an organic (eg urea, glutamate) source. In addition to adequate carbon and nitrogen sources, fermentation media can too. contain suitable minerals, salts, cofactors, buffers, vitamins and other components known to those skilled in the art suitable for microorganism growth e.g. promotion of the enzymatic pathways necessary for the production of lipids.
[486] [486] A suitable pH range for fermentation is typically between about pH 4.0 to pH 8.0, where pH 5.5 to pH 7.0 is preferred as a range for initial growth conditions. Fermentation can be carried out under aerobic or anaerobic conditions, where microaerobic conditions are preferred.
[487] [487] Typically, the accumulation of high levels of lipids in the cells of oleaginous microorganisms requires a two-step process, as the metabolic state must be "balanced" between growth and fat synthesis/storage. Thus, most preferably, a two-stage fermentation process is required for the production of lipids in microorganisms. In this approach, the first phase of fermentation is dedicated to the generation and accumulation of cell mass, and is characterized by rapid cell growth and cell division. In the second stage of fermentation, it is preferable to create nitrogen deprivation conditions in the culture to promote high levels of lipid accumulation. The effect of the nitrogen deprivation present is to reduce the effective concentration of AMP in the cells, thereby reducing the NAD-dependent isocitrate dehydrogenase activity of mitochondria. When this occurs, citric acid will accumulate, thus forming abundant pools of acetyl-CoA in the cytoplasm and conditioning fatty acid synthesis. Thus, this phase is characterized by the cessation of cell division, followed by fatty acid synthesis and TAGS accumulation.
[488] [488] Although cells are typically grown at about 30°C, some studies have shown increased synthesis of unsaturated fatty acids at lower temperatures. Based on the economics of the process, this temperature change is likely to occur after the first stage of the two-stage fermentation, where most of the microorganism growth has taken place.
[489] [489] It is contemplated that a variety of fermentation process models may be applied where commercial lipid production using instant nucleic acids is desired.
[490] [490] A batch fermentation process is a closed system where the composition of the medium is defined at the beginning of the process and is not subject to additions other than those necessary to maintain pH and oxygen levels during the process. Thus, early in the culture process the medium is inoculated with the desired organism and growth or metabolic activity is allowed to occur without the addition of additional substrates (ie, carbon and nitrogen sources) to the medium. In the batch process, the metabolite and biomass compositions of the system change constantly until the moment the culture is finished. In a typical discontinuous process, cells moderate through a static lag phase to a high log growth phase and finally to a stationary phase, where the growth rate is slowed or stopped. Left untreated, cells in the stationary phase will eventually die. A variation of the standard batch process is the fed-batch process, where substrate is continuously added to the fermenter during the course of the fermentation process. A semi-continuous process is also suitable in the present invention. Fed-batch processes are useful where catabolic repression is able to inhibit cell metabolism or where it is desirable to have limited amounts of substrate in the media at any one time. Measuring substrate concentration in batch fed systems is difficult and therefore can be estimated based on changes in measurable factors such as pH, dissolved oxygen, and residual gas partial pressure (eg CO2). Batch and fed-batch culture methods are common and well known in the art and examples can be found in Brock, in Biotechnology: A Textbook of Industrial Microbiology, ed 2.sup.nd, Sinauer Associates, Sunderland, Massachusetts, USA, (1989 ), or Deshpande (1992).
[491] [491]Commercial lipid production using instant cells can also be achieved by a continuous ferretting process, where a defined medium is continuously added to a bioreactor, while the same amount of culture volume is simultaneously removed for the product recovery. Continuous cultures generally keep cells in the log phase of growth at a constant cell density. Continuous or semi-continuous culture methods allow for the modulation of one factor or any number of factors that affect cell growth or final product concentration. For example, one approach might limit the carbon source and allow all other parameters to moderate metabolism. In other systems, a number of factors that affect growth can be continually altered while cell concentration, as measured by the turbidity of the medium, is kept constant. Continuous systems strive to maintain steady state growth and therefore the rate of cell growth must be balanced with the loss of cells due to material being removed from the culture. Nutrient and growth factor modulation methods for continuous culture processes, as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed in Brock, supra.
[492] [492] Fatty acids, including PUFAs, can be found in the host microorganism as free fatty acids or in esterified forms such as acylglycerols, phospholipids, sulfolipids or glycolipids, and can be extracted from the host cell through a variety of well-known means in technique.
[493] [493] In general, means for purifying fatty acids, including PUFAs, may include organic solvent extraction, sonication, supercritical fluid extraction (eg using carbon dioxide), saponification, and physical media, like presses, or combinations thereof. Of particular interest is the extraction with methanol and chloroform, in the presence of water (Bligh and Dyer, 1959). When desirable, the aqueous layer can be acidified to protonate negatively charged portions and thus enhance the partition of the desired products into the organic layer. After extraction, the organic solvents can be removed by evaporation under a stream of nitrogen. When isolated in conjugated forms, the products can be enzymatically or chemically cleaved to release the free fatty acid or a less complex conjugate of interest, and can then be subjected to further manipulations to produce a desired end product.
[494] [494] If further purification is required, standard methods can be used. Such methods may include extraction, urea treatment, fractional crystallization, HPLC, fractional distillation, silica gel chromatography, centrifugation or high speed distillation, or combinations of these techniques. Protection of reactive groups such as acid or alkenyl groups can be done at any step by known techniques (eg alkylation, iodination). Methods used include the methylation of fatty acids to produce methyl esters. Likewise, protective groups can be removed at any step. Desirably, purification of fractions containing GLA, STA, ARA, DHA and EPA can be accomplished by treatment with urea and/or fractional distillation.
[495] [495] An example of the use of plant biomass for the production of a biomass slurry using yeast is described in WO 201.1/100272.
[497] [497] As used herein the term "biofuel" includes biodiesel and bioalcohol. Biodiesel can be prepared from oils derived from plants, algae and fungi. Bioalcohol is produced from the fermentation of sugar. This sugar can be extracted directly from plants (eg sugar cane), derived from plant starch (eg corn or wheat) or made from cellulose (eg wood, leaves or stalks).
[498] [498] Biofuels currently cost more to produce than petroleum fuels. In addition to processing costs, biofuel crops require planting, fertilization, application of pesticides and herbicides, harvesting and transport. The plants, algae and fungi of the present invention can reduce biofuel production costs.
[499] [499] General methods for producing biofuel can be found in, for example, Maher and Bressler, 2007; Greenwell et al, 2010; Karmakar et al, 2010; Alonso et al, 2010; Lee and Mohamed, 2010; Liu et al, 2010a; Gong and jiang, 2011; Endalew et al, 2011; Semwal et al., 2011. Bioalcohol
[500] [500]The production of biologically produced alcohols, eg ethanol, propanol and butanol is well known. Ethanol is the most common bioalcohol.
[501] [501] The basic steps for large-scale ethanol production are as follows: 1) microbe fermentation (eg yeast) of sugars, 2) distillation, 3) dehydration, and optionally 4) denaturation. Before fermentation, some cultures require saccharification or hydrolysis of carbohydrates such as cellulose and starch into sugars. Cellulose saccharification is called cellulolysis. Enzymes can be used to convert starch to sugar.
[502] [502]Bioalcohol is produced by microbial fermentation of sugar. Microbial fermentation will currently only work directly with sugars. Two important plant components, starch and cellulose, are both composed of sugars, and can, in principle, be converted to sugars for fermentation. Distillation
[503] [503]For ethanol to be usable as a fuel, most of the water must be removed. Most of the water is removed by distillation, but purity is limited to 95-96% due to the formation of a low boiling water-ethanol azeotrope with the maximum (95.6% m/m (96.5 m/m) %v/v) ethanol and 4.4% m/m (3.5°sv/v) water). This mixture is called hydrous ethanol and can be used as a fuel alone, but unlike anhydrous ethanol, hydrous ethanol is not miscible in all proportions with gasoline, so the water fraction is typically removed by further treatment. in order to burn in combination with gasoline in gasoline engines.
[504] [504]Water can be removed from an ethanol/azeotropic water mixture by dehydration. Azeotropic distillation, used in many early fuel ethanol plants, consists of adding benzene or cyclohexane to the mixture. When these components are added to the mixture, it forms a heterogeneous azeotropic mixture in vapor-liquid-liquid equilibrium which, when distilled, produces anhydrous ethane at the bottom of the column, and a mixture of water vapor and cyclohexane/benzene. When condensed, it becomes a two-phase liquid mixture. Another early method, called extractive distillation, is the addition of a ternary component that will increase the relative volatility of ethanol. When the ternary mixture is distilled, it will produce anhydrous ethanol in the column's top flow.
[505] [505] A third method has emerged and has been adopted by most modern ethanol plants. This new process uses molecular sieves to remove water from the ethanol fuel.
[506] [506]The production of biodiesel, or alkyl esters, is well known. There are three basic routes for the production of ester from lipids: 1) Transesterification by basic lipid catalysis with alcohol; 2) Direct esterification by acid catalysis of lipids with methanol; and 3) Conversion of lipids to fatty acids and then to alkyl esters with acid catalysis.
[507] [507] Any method of preparing fatty acid alkyl esters and glyceryl esters (wherein one, two or three of the hydroxy groups in glycerol are etherified) can be used. For example, fatty acids can be prepared, for example, by hydrolyzing or saponifying triglycerides with acid or base catalysts, respectively, or using an enzyme such as a lipase or an esterase. Fatty acid alkyl esters can be prepared by reacting a fatty acid with an alcohol in the presence of an acid catalyst. Fatty acid esters can be further prepared by reacting a triglyceride with an alcohol in the presence of an acid or base catalyst. Glycerol esters can be prepared, for example, by reacting glycerol with an alkyl halide in the presence of base, or with an olefin or alcohol in the presence of an acid catalyst.
[508] [508] In some preferred embodiments, lipids are transesterified to produce methyl esters and glycerol.
[509] [509] Alkyl esters can be directly blended with diesel oil, or washed with water or other aqueous solutions to remove various impurities, including catalysts, prior to blending. It is possible to neutralize acid catalysts with a base. However, this process produces salt. To avoid engine corrosion, it is preferable to minimize the salt concentration in the fuel additive composition. Salts can be substantially removed from the composition, for example, by washing the composition with water.
[510] [510] In another embodiment, the composition is dried after being washed, for example by passing the composition through a drying agent such as calcium sulfate.
[511] [511] In yet another embodiment, a neutral fuel additive is obtained without producing salts of or using a wash step, using a polymeric acid, such as Dowex 50"", which is a resin that contains sulfonic acid groups. The catalyst is easily removed by filtration after the esterification and etherification reactions are complete.
[512] [512] Use of plant triacylglycerols for biofuel production is reviewed in Durrett et al. (2008).
[513] [513] Vegetable oils are primarily composed of five common fatty acids, namely palmitate (16:0), stearate (18:0), oleate (18:1), linoleate (18:2) and linolenate (18:3) , although, depending on the particular species, larger or smaller fatty acids may also be major constituents.
[514] [514]Most vegetable oils are derived from triacylglycerols stored in seeds. However, the present invention also provides methods for increasing the oil content in vegetative tissues. The plant tissues of the present invention have a higher total lipid yield. Also, the level of oleic acid is significantly increased while the polyunsaturated alpha-linolenic acid fatty acid has been reduced.
[515] [515] Once a leaf is developed, it undergoes a shift in development from sink (nutrient absorption) to source (provide sugars). In food crops, most sugars are translocated from the source leaves to support the growth of new leaves, roots and fruits. Because carbohydrate translocation is an active process, there is a loss of carbene and energy during translocation. Furthermore, / after the developing seed absorbs carbon from the plant, there are additional carbon and energy losses associated with the conversion of carbohydrates to oil, protein or other major components of the seed (Goffman et al., 2005) . Plants of the present invention increase the energy content of leaves and/or stalks so that the entire above-ground plant can be harvested and used to produce biofuel.
[516] [516] Algae store oil within the cell body. sometimes, but not always in vesicles. This oil can be recovered in a number of relatively simple ways, including solvents, heat, and/or pressure. However, these methods generally only recover about 80% to 90% of the stored oil. Processes that offer more effective oil extraction methods that can recover about 100% of the stored oil at low cost are known in the art. These processes include or consist of depolymerization, such as biologically breaking down algal walls and/or cell oil vesicles, if present, to release the oil from the oil-producing algae.
[517] [517] In addition, there are a large number of viruses that invade and break down algal cells, and may thus release cell contents, in particular, stored starch or oil. Such viruses are an integral part of the algae ecosystem, and many viruses are specific to a single type of algae. Specific examples of such viruses include chlorella virus PBCV-1 (Paramecium Bursaria Chlorella Virus), which is specific for certain Chlorella algae, and cyanophages such as SM-1, P-60 and AS-l specific for blue-green algae Synechococcus. The particular virus selected will depend on the particular species of alga being used in the growth process. One aspect of the present invention is the use of such a virus to disrupt the algae so that the oil contained within the algal cell wall can be recovered. In another detailed aspect of the present invention, a mixture of biological agents can be used to disrupt algal cell walls and/or oil vesicles.
[518] [518] Mechanical crushing eg a pressing or solvent recovery step hexane or butane, supercritical fluid extraction, or as may also be useful to extract the oil from the oil vesicles of oil-producing algae. Alternatively, mechanical approaches can be used in combination with biological agents in order to improve the reaction rate and/or separation of materials. Regardless of the specific biological agent or agents chosen, these can be introduced in quantities that are sufficient to serve as the main mechanism by which algae oil is released from oil vesicles in oil-producing algae, ie not a merely incidental presence of any of these.
[519] [519] Once the oil has been released from the algae it can be recovered or separated from a slurry of algal debris material, eg cell debris, oil, enzyme, by-products, etc. This can be done by sedimentation or centrifugation, with centrifugation generally being faster. Starch production can follow similar separation processes.
[520] [520]An algae feed can be formed from a biomass feed source as well as an algae feed source. Biomass from terrestrial or algae sources can be depolymerized in a variety of ways, such as, but not limited to, saccharification, hydrolysis or the like. The source material can be almost any sufficiently voluminous cellulose, lignocellulose, polysaccharide or carbohydrate, glycoprotein, or other material that forms the cell wall of the source material.
[521] [521] The fermentation step may be conventional in its use of yeast to ferment sugar into alcohol. The fermentation process produces carbon dioxide, alcohol, and algae husks. All of these products can be used in other parts of the process and systems of the present invention, with substantially no unused material or wasted heat. Alternatively, if ethanol is so produced, it can be sold as a product or used to produce ethyl acetate for the transesterification process. Similar considerations apply to alcohols other than ethanol.
[522] [522] Algae oil can be converted to biodiesel through a process of direct hydrogenation or transesterification of algae oil. Seaweed oil is in a similar form as most vegetable oils, which are in the form of triglycerides. A triglyceride composed of three fatty acid chains, one attached to each of the three carbon atoms in a glycerol backbone. This form of oil can be burned directly. However, the properties of oil in this form are not ideal for use in a diesel engine, and without ryodification, the niotor will soon run poorly or fail. In accordance with the present invention, the triglyceride is converted to biodiesel, which is a semethant, but superior to petroleum diesel fuel in many respects.
[523] [523] One process for converting triglyceride to biodiesel is transesterification, and includes reacting the triglyceride with alcohol or another acyl receptor to produce glycerol and free fatty acid esters. Free fatty acids are in the form of fatty acid alkyl esters (FAAE).
[524] [524] With the chemical process, additional steps are required to separate the catalyst and clean the fatty acids. Furthermore, if ethanol is used as an acyl acceptor, it must be essentially dry, to avoid soap production through saponification in the process, and the glycerol must be purified. The biological process, by comparison, can accept ethanol in its dry state, and cleaning and purification of biodiesel and glycerol is much easier.
[525] [525] Transesterification often uses a simple alcohol, typically petroleum-derived methanol. When methanol is used the resulting biodiesel is called fatty acid methyl ester (FAME) and most of the biodiesel sold today, especially in Europe, is FAME. However, ethanol can also be used as the alcohol in transesterification, in which case the biodiesel is fatty acid ethyl ester (FAEE). In the US, the two types are generally not distinct, and are collectively known as fatty acid alkyl esters (FAAE), which as a generic term can apply regardless of the acyl receptor used. Direct hydrogenation can also be used to convert at least a portion of the algal oil to biodiesel. As such, in one aspect, the biodiesel product can include an alkane.
[526] [526] Algal triglyceride can also be converted to biodiesel by direct hydrogenation. In this process, the products are chains of alkanes, propane, and water. The glycerol backbone is hydrogenated to propane, so there is substantially no glycerol produced as a by-product. Also, no alcohol or transesterification catalysts are needed. All biomass can be used as feed for oil producing algae with no need for fermentation to produce alcohol for transesterification. The resulting alkanes are pure hydrocarbons, without oxygen, so the biodiesel produced in this way has a slightly higher energy content than the alkyl esters, degrades more slowly, does not attract water, and has other desirable chemical properties.
[527] [527] The present invention includes compositions that can be used as feed. For purposes of the present invention, "feed" includes any food or preparation for human or animal consumption (including for enteral and/or parenteral consumption) which, when administered to the body: (1) serves to nourish or build tissue or provide energy, and /or (2) maintain, restore or support appropriate nutritional status or metabolic function. The rations of the invention include nutritional compositions for infants and/or young children.
[528] [528] The rations of the invention comprise, for example, a cell of the invention, a plant of the invention, a part of the plant of the invention, a seed of the invention, an extract of the invention, the product of a method of the invention, the product of a fermentation process of the invention, or a composition together with a suitable carrier. The term "carrier" is used in its broadest sense to encompass any component that may or may not have nutritional value. As the person skilled in the art will appreciate, the carrier must be suitable to be used (or used in a sufficiently low concentration) in a feed, such that it has no harmful effect on an organism that consumes the feed.
[529] [529] The feed of the present invention comprises a lipid produced directly or indirectly by using the methods, cells or organisms disclosed herein. The composition can be in solid or liquid form. Furthermore, the composition can include edible macronutrients, vitamins and/or minerals in amounts desired for a particular use. The amounts of these ingredients vary depending on whether the composition is intended for use with normal individuals or for use with individuals having special needs such as individuals suffering from metabolic disorders and the like. , ln l
[530] [530] Examples of suitable nutritive value carriers include, among others, macronutrients such as edible fats, carbohydrates, and proteins. Examples of such edible fats include, among others, coconut oil, borage oil, fungus oil, gooseberry oil, soybean oil and mono- and di-glycerides. Examples of such carbohydrates include, among others, glucose, edible lactose, and hydrolyzed starch. Furthermore, examples of proteins that can be used in the nutritional composition of the invention include, among others, soy proteins, electrodialyzed whey, electrodialyzed skim milk, whey, or the hydrolysates of these proteins.
[531] [531] With respect to vitamins and minerals, the following may be added in the feed compositions of the present invention, calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine and vitamins A, E, D, C and the B complex. Other vitamins and minerals can also be added.
[532] [532] The components used in the feed compositions of the present invention can be of semi-purified or purified origin. By semi-purified or purified is meant a material that has been prepared by purification from a natural material or by de novo synthesis.
[533] [533] A feed composition of the present invention can also be added to feed, even when dietary supplementation is not required. For example, the composition can be added to foods of any type, including, but not limited to, margarine, modified butter, cheese, milk, yogurt,
[534] [534] The genus Saccharomyces spp is used in the fermentation of beer and wine and also as a baking agent, especially bread. Yeast is the main constituent of plant extracts. Yeast is also used as an additive in animal feed. It will be apparent that genetically modified yeast strains can be provided which are adapted to synthesize lipids as described herein. These yeast strains can be used in food rations and in the production of wine and beer to provide products with an improvement in lipid content.
[535] [535] In addition, lipids produced in accordance with the present invention or transforming host cells to contain and express the object genes, can also be used as food supplements for animals to alter the fatty acid composition in tissue or milk of an animal, to a more desirable one, for human or animal consumption. Examples of such animals include sheep, cattle, horses and the like.
[536] [536] In addition, the feeds of the invention can be used in aquaculture to increase fatty acid levels in fish for human or animal consumption.
[537] [537] Preferred feeds of the invention are plants, seeds and other parts of plants, such as leaves, fruits and stems that can be used directly as food or for feeding humans or other animals. For example, animals can either graze directly on such field-grown plants, or be fed measured amounts in controlled feeding. The invention includes the use of plants and plant parts as food to increase levels of polyunsaturated fatty acids in humans and other animals.
[538] [538] The present invention also encompasses compositions, particularly pharmaceutical compositions, which comprise one or more lipids produced using the methods of the invention.
[539] [539] The pharmaceutical composition may include one or more of the lipids, in combination with a standard, known, non-toxic, pharmaceutically acceptable carrier, adjuvant or vehicle such as phosphate buffer saline, water, ethanol, polyols, vegetable oils, an agent wetting agent or an emulsion such as an oil/water emulsion. The composition can be in liquid or solid form. For example, the composition may be in the form of a tablet, capsule, ingestible liquid, powder, ointment or topical cream. Proper fluidity can be maintained, for example, by maintaining the required particle size in the case of a dispersion and by using surfactants. It may also be desirable to include isotonic agents, for example, sugars, sodium chloride and the like. In addition to these inert diluents, the composition can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents and odorizing agents.
[540] [540] Suspensions, in addition to active compounds, may include suspending agents such as ethoxylated isostearate alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances.
[541] [541] Solid dosage forms such as tablets and capsules can be prepared using techniques well known in the art. For example, lipids produced in accordance with the present invention can be compressed with conventional compression bases such as lactose, sucrose and corn starch in combination with binders such as acacia, corn starch or gelatin, disintegrating agents such as potato starch or alginic acid and a lubricant such as stearic acid or magnesium stearate. Capsules can be prepared by incorporating these excipients into a gelatin capsule along with antioxidants and the relevant lipids.
[542] [542] For intravenous administration, the lipids produced in accordance with the present invention or their derivatives can be incorporated into commercial formulations.
[543] [543] A typical dosage of a given fatty acid is between 0.1 mg to 20 g, taken from one to five times a day (up to 100 g daily) and is preferably in the range of about 10 mg to about 1, 2, 5, or 10 g daily (taken in single or multiple doses). As known in the art, a minimum of 300 mg/day of fatty acids, especially polyunsaturated fatty acids, is desirable. However, it will be appreciated that any amount of fatty acid will be beneficial to the subject.
[544] [544] Possible routes of administration of the pharmaceutical compositions of the present invention include, for example, enteral and parenteral. For example, a liquid preparation can be administered orally. Furthermore, a homogeneous mixture can be completely dispersed in water under sterile conditions with physiologically acceptable diluents, preservatives, buffers or propellants to form a spray or inhaler.
[545] [545] The dosage of the composition to be administered to the subject can be determined by a person skilled in the art and depends on various factors such as weight, age, general health, past history, immune status, etc. , of the subject.
[547] [547] The terms "polypeptide" and "protein" are often used interchangeably.
[548] [548] A polypeptide or class of polypeptides can be defined by the extent of identity (% identity), of its amino acid sequence to a reference amino acid sequence, or by having a greater °5 identity to an amino acid sequence reference than the other. The % identity of a polypeptide with a reference amino acid sequence is usually determined by GAP analysis (Needleman and Wunsch, 1970; GCG Program) with parameters of a gap creation penalty = 5 and a gap extension penalty = 0.3. The query sequence is at least 100 amino acids long and the GAP analysis aligns the two sequences in a region of at least 100 amino acids. More preferably, the query sequence is at least 250 amino acids long and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. More preferably, GAP analysis aligns two sequences along their entire length. The polypeptide or class of polypeptides may have the same enzymatic activity, or one activity different, or lacking in activity, from the reference polypeptide Preferably, the polypeptide has an enzymatic activity of at least 10% of the activity of the reference polypeptide.
[549] [549] As used herein a "biologically active fragment" is a part of a polypeptide of the invention that maintains a defined activity of a complete reference polypeptide, eg, MGAT activity. Biologically active fragments as used herein exclude the cornPieto polypeptide. Biologically active fragments can be parts of any size while retaining defined activity. Preferably, the biologically active fragment retains at least 10% of the activity of the complete polypeptide.
[550] [550] With respect to a particular polypeptide or enzyme, it will be appreciated that calculated % identity greater than those provided herein will encompass preferred embodiments. Thus, where applicable, in light of the calculated minimum °5 identity, it is preferred that the polypeptide/enzyme comprises an amino acid sequence that is at least 60%, preferably at least 65°, preferably at least 70%, preferably at least 60%. at least 75%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 91%, preferably at least 92%, preferably at least 93%, preferably at least 94%, preferably at least 95 %, preferably at least 96%, preferably at least 97%, preferably at least 98%, preferably at least 99%, preferably at least 99.1%, preferably at least 99.2%, preferably at least 99.3%, at least 99.4%, preferably at least 99.5%, preferably at least 99.6%, preferably at least 99.7%, preferably at least 99.8%, and most preferably at least 99.9% the same. matches the relevant named SEQ ID NO.
[551] [551] Amino acid sequence mutants of polypeptides defined herein may be prepared by introducing appropriate nucleotide changes into a nucleic acid defined herein, or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletions, insertions and substitutions can be made to arrive at the final construct, as long as the final product of the polypeptide has the desired characteristics.
[552] [552] Mutant (altered) polypeptides can be prepared using any technique known in the art, for example, using directed evolution or rational design strategies (see below). Products derived from mutated/altered DNA can easily be selected using techniques described here to determine whether they possess fatty acid acyltransferase activity, eg MGAT, DGAT or GPAT/phosphatase activity.
[553] [553]In designing amino acid sequence mutants, the position of the mutation site and the nature of the mutation will depend on the characteristics to be modified. Mutation sites can be modified individually or serially, for example,
[554] [554] Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to residues and usually about 1 to 5 contiguous residues.
[555] [555]Substitution mutants have at least one amino acid residue in the polypeptide removed and a different residue inserted in its place. Sites of greatest interest for substitutional mutagenesis include sites identified as active sites. Other sites of interest are those where certain residues obtained from various strains or species are identical. These positions may be important for biological activity. sites, especially those that are a sequence of at least three other identical conserved, preferably are substituted in a relatively conservative manner Such conservative substitutions are shown in Table 1 under the heading of "exemplary substitutions".
[556] [556] In a preferred embodiment a mutant/variant polypeptide has only or no more than one or two or three or four conserved amino acid changes when compared to a natural polypeptide. Details of the conserved amino acid changes are given in Table 1. As the skilled person would be aware, these small changes can reasonably be predicted not to alter the activity of the polypeptide when expressed in a recombinant cell.
[557] [557] In directed evolution, random mutagenesis is applied to a protein and a selection regimen is used to choose those variants that possess the desired qualities, eg, increased fatty acid acyltransferase activity. New rounds of mutation and selection are then applied. A typical directed evolution strategy involves three steps: 1) Diversification: The gene encoding the protein of interest is mutated and/or randomly recombined to create a large library of gene variants. Gene variant libraries can be constructed with error-prone PCR (see, for example, Leung, 1989; Cadwell and joyce, 1992), from groups of fragments digested by DNasel·prepared from parental templates (Stemmer, 1994a; Stemmer, 1994b; Crarneri et al., 1998; Coco et al., 2001) from degenerate oligonucleotides (Ness et al., 2002, Coco, 2002) or mixtures of both, or from undigested parental templates (Zhao et al., 1998; Eggert et al., 1998; Eggert et al., 2002) al., 2005; jezéquek et al., 2008) and are usually assembled by PCR.
[558] [558]together, these three steps are called a "round" of directed evolution. Most experiments will involve more than one round. In these experiments, the "winners" from the previous round are diversified into the next round to create a new library. At the end of the experiment, all evolved proteins or polynucleotide mutants are characterized using biochemical methods. rational design
[559] [559] A protein can be rationally designed, based on known information about the protein's structure and folding. This can be done by drawing from scratch (redraw) or by redrawing based on native structures (see, for example, Hellinga, 1997; and Lu and Berry, Protein Sturcture Design and Engineering, Handbook of Proteins 2, 1153-1157 (2007)). Protein design usually involves identifying sequences that fold into a particular structure or target and can be done using computer models. Computational protein design algorithms look for sequence conformation space for sequences that are of low energy when folded into the target structure. Computational protein design algorithms use protein energy models to assess how mutations would affect a protein's structure and function. These energy functions typically include a combination of molecular mechanics, statistics (ie, knowledge-based), and other empirical terms. A suitable program available includes IPRO
[560] [560] Also included within the scope of the invention are polypeptides defined herein that are differentially modified during or after synthesis, for example, by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage , binding to an antibody molecule or other cellular ligand, etc. Such modifications may serve to enhance the stability or bioactivity of the polypeptide of the invention. Identification of Fatty Acid Acyltransferases
[561] [561] In one aspect, the invention provides a method for identifying a nucleic acid molecule encoding a fatty acid acyltransferase having an enhanced ability to produce MAG, DAG and/or TAG in a cell.
[562] [562] The method comprises obtaining a cell which contains a nucleic acid molecule encoding an acyltransferase operably linked to a promoter which is active in the cell. The nucleic acid molecule can encode a natural acyltransferase such as MGAT, GPAT and/or DGAT or a mutant(s) thereof. Mutants can be designed using standard procedures in the technique (see above), such as by means of random mutagenesis, targeted mutagenesis or saturation mutagenesis in known genes of interest, or by subjecting different genes to DNA shuffling. For example, a polynucleotide comprising a selected sequence from any of SEQ ID NOS: 1 to 44 encoding an MGAT can be mutated and/or randomly recombined to create a large library of gene variants (mutants) using eg PCR error-prone and/or DNA scrambling. Mutants can be selected for further investigation on the basis that they comprise a conserved amino acid motif. For example, in the case of a candidate nucleic acid encoding an MGAT, a skilled person can determine whether it comprises a sequence in SEQ ID NOs: 220, 221, 222, 223 and/or 224 before testing whether the nucleic acid encodes for a functional MGAT mutant (by transfection for example, into a host cell, such as a plant cell and analyzing for fatty acid acyltransferase activity (ie, MGAT activity as described here).
[563] [563] Direct PCR sequencing of nucleic acid or a fragment thereof can be used to determine the exact nucleotide sequence and deduce the corresponding amino acid sequence and thus identify conserved amino acid sequences. Degenerate primers based on conserved amino acid sequences can be used to direct PCR amplification. Degenerate primers can also be used as probes in DNA hybridization assays. Alternatively, conserved amino acid sequences can be detected in protein hybridization assays that use, for example, an antibody that specifically binds to the conserved amino acid sequences, or to a substrate that specifically binds to the conserved amino acid sequences such as, per example, a lipid that binds to FLXLXXXN (a putative neutral lipid-binding domain; SEQ ID NO:224).
[564] [564] In one embodiment, the nucleic acid molecule is composed of a nucleotide sequence that encodes an MGAT. The nucleotide sequence can i) comprise a . sequence selected from any one of SEQ ID NOS: 1 to 44, ii) encode a polypeptide composed of amino acids, having a sequence, as in any one of SEQ ID NOS: 45 to 82, or a biologically active fragment thereof, iii) to be at least 50% identical to i) or ii), or iv) hybridize to any one of i) to iii) under stringent conditions. In another or additional embodiment, the nucleic acid molecule is composed of a nucleotide sequence encoding one or more conserved DGAT2 and/or MGAT 1/2 amino acid sequences in SEQ ID NOS: 220, 221, 222, 223 and 224. In a preferred embodiment, the nucleic acid molecule comprises a nucleotide sequence that encodes the conserved amino acid sequences set forth in SEQ ID NO:220 and/or SEQ ID NO:224.
[565] [565] In another embodiment, the nucleic acid molecule is composed of a nucleotide sequence that encodes a GPAT, preferably a GPAT that has phosphatase activity. The nucleotide sequence may i) comprise a sequence selected from any one of SEQ ID NOS: 84 to 141, ii) encode a polypeptide composed of amino acids having a sequence as in any one of SEQ ID NOS: 144 to 201, or a biologically active fragment thereof, iii) be at least 50% identical to i) or ii), or iv) hybridize to any one of i) to iii) under stringent conditions. In another or additional embodiment, the nucleic acid molecule is composed of a nucleotide sequence that encodes one or more conserved GPAT amino acid sequences as in SEQ ID NOS: 225, 226 and 227, or a sequence of amino acids that is at least 50%, preferably at least 60%, preferably at least 65% identical thereto.
[566] [566] In another embodiment, the nucleic acid molecule is composed of a nucleotide sequence that encodes a DGAT2. The nucleotide sequence may i) comprise a nucleotide sequence selected from any one of SEQ ID NO:204 to 211, ii) encode a polypeptide composed of amino acids, having a sequence, as in any one of SEQ ID NO: 212 to 219, or a biologically active fragment thereof, iii) be at least 50% identical to i) or ii), or iv) hybridize to any one of i) to iii) under stringent conditions. In a preferred embodiment, DGAT2 comprises a nucleotide sequence of SEQ ID NO:204 and/or a nucleotide sequence encoding a polypeptide composed of amino acids, having a sequence of SEQ ID NO:212.
[567] [567] A cell composed of a nucleic acid molecule encoding a fatty acid acyltransferase operably linked to a promoter that is active in the cell can be obtained using standard procedures in the art such as by introducing the nucleic acid molecule into a cell by , for example, calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments. Other methods of cell transformation can also be used and include, among others, introducing DNA into plants by direct transfer or DNA injection. Cells from transformed plants can also be obtained using Agrobacterium-mediated transfer and acceleration methods as described herein.
[568] [568] The method further comprises determining whether the level of MAG, DAG and/or TAG produced in the cell has increased compared to a corresponding cell deficient in nucleic acid using techniques known in the art such as those exemplified in Example 1. For example , lipids can be extracted into a chloroform/methanol solution, dried and separated by thin layer chromatography (TLC). Tag IDs DAG, MAG, free fatty acids and other lipids can be verified with internal lipid standards after staining with iodine vapor. The resulting chromatograms can be analyzed using a Phosphorlmager and the amount of MAG, DAG and TAG measured as a function of the known amount of internal standards, or alternatively, the cells can be fed sn-2 monooleoylglycerol [14C] or [14C]-glycerol -3-phosphate and the associated radioactivity quantified by liquid scintillation counter (i.e., the amount of MAG, DAG, and labeled TAG is negligible).
[569] [569] The method further comprises identifying a nucleic acid molecule encoding a fatty acid acyltransferase having an enhanced ability to produce MAG, DAG and/or TAG in a cell. In a preferred embodiment, acyltransferase catalyzes an enzymatic reaction in the MGAT pathway. Still in a preferred modality, DAG is increased through the mgat pathway (i.e., the acylation of MAG with fatty acyl -COA is catalyzed by a MGAT to form DAG). In another or additional embodiment, the MAG substrate is produced by a GPAT which also has phosphatase activity and/or the DAG is acylated with the fatty acyl-CoA by a DGAT and/or a MGAT with DGAT activity to form TAG. Shine
[570] [570]Some aspects of the invention relate to measuring the brightness of vegetative material, as a marker for the level of lipids in the material, with higher levels of brightness being associated with higher levels of lipids.
[571] [571] The brightness of vegetative material can be determined using known processes. Gloss Meter (reflectometers) provide a quantifiable way to measure glare intensity ensuring measurement consistency by defining accurate lighting and viewing conditions. The configuration of both the light source and observation reception angles allows measurement over a small range of the general reflection angle. The measurement results of a gloss meter are related to the amount of light reflected from a black glass standard with a defined refractive index. The ratio of reflected to incident light for the specimen, compared to the ratio for the standard brightness, is recorded as brightness units.
[572] [572]The measurement scale, Gloss Units (GU), of a gloss meter is a scaling based on a highly polished black glass reference standard with a defined refractive index having a specular reflectance of IOOGU at the specified angle. This standard is used to set an upper calibration point of 100 with the lower end point set to 0 on a perfectly matte surface. This step is suitable for most non-metallic materials.
[573] [573] The ideal or expected level of vegetative material brightness is likely to vary among plant species.
[574] [574]The genes were expressed in plant cells, essentially using a transient expression system as described by Voinnet et al. (2003) and Wood et al. (2009). Binary vectors containing the coding region to be expressed by a strong constitutive e35S promoter that contains a duplicated enhancer region were introduced into AGLI strain of Agrobacterium tumefaciens. A chimeric binary vector, 35S:p19, for expression of the viral silent suppressor, p19, separately was introduced into AGLI as described in WO2010/057246. A chimeric binary vector, 35S:V2, for expression of viral silencing suppressor V2 was separately introduced into AGLI. Recombinant cells were grown to stationary phase at 28°C in LB medium supplemented with 50mg/L of kanamycin and 50 mg/L of rifampicin.
[575] [575] Previously infiltrated Nicotiana benthamiana leaf tissues as described above were cultured in a solution containing 0.1 M potassium phosphate buffer (pH 7.Z) and 0.33 M sucrose using a glass homogenizer. The leaf homogenate was centrifuged at 20,000 g for 45 minutes at 4°C, after which each supernatant was collected. Protein content in each supernatant was measured according to Bradford (1976), using a Wallac1420 multi-label counter and a 131o-Rad Protein Assay dye reagent (Bio-Rad Laboratories, Hercules, CA USA). Acyltransferase assays used 100 µg of protein according to Cao et al. (2007) with some modifications. The reaction medium contained 100 mM Tris-HCl (pH 7.0), 5 mM MgCl 2 , 1 mg/ml BSA (fatty acid free), 200 mM sucrose, 40 nM cold oleoyl-CoZ i , 16.4 µM sn 2 mono-oleoylglycero1 [i'ç] (55mCi/mmol, American Radiochemicals, Saint Louis, MO USA) or 6.0 µM ["C]glycerol-3-phosphate salt (G- 3-P) disodium (150 mCi/mmol, American Radiochemicals) Assays were performed for 7.5, 15 or 30 minutes Lipid analysis
[576] [576] In summary, the methods used for lipid analysis in seeds or vegetative tissues were as follows: Arabidopsis seed and any other seed of similar size: (i) fatty acid composition - direct methylation of acids fats in seeds, without crushing seeds.
[578] [578] Whenever the oil content of the seed was determined in small seeds such as Arabidopsis seeds, the seeds were dried in a desiccator for 24 hours and approximately 4 mg of seed was transferred to a 2 ml glass jar with a lid. donut containing teflon coating. 0.05 mg triheptadecanoine dissolved in 0.1 ml toluene was added to the vial as an internal standard. FAME seeds were prepared by adding 0.7 ml of 1N methanolic HCl (Supelco) to the vial containing the serrant material. Seed crushing was not necessary, with small seeds such as Arabidopsis seeds. The mixture was vortexed and briefly incubated at 80°C for 2 hours. After cooling to room temperature, 0.3 ml of 0.9% (w/v) NaCl and 0.1 ml of hexane were added to the flask and mixed well for 10 minutes in a Heidolph Vibrarnax 110.
[580] [580]After harvest at plant maturity, Camelina or canola seeds were desiccated by storing the seeds for 24 hours at room temperature in a desiccator with silica gel as a desiccant. The moisture content of seeds is typically 6-8%. Total lipids were extracted from known weights of dissected seeds by crushing the seeds with a mixture of chloroform and methanol (2/1 v/v) in an eppendorf tube using a Reicht tissue lyser (22 frequency/seconds, for 3 minutes) and a metal ball. A volume of 0.1 M KCl was added and the mixture was stirred for 10 minutes. The smaller apolar phase was collected after centrifuging the mixture for 5 minutes at 3000 rpm. The remaining upper (aqueous) phase was washed with 2 volumes of chloroform through the mixture for 10 minutes. The second non-polar phase was also collected and combined with the first. The solvent was evaporated from the lipids present in the extract under nitrogen flow and the total dry lipid was dissolved in a known volume of chloroform.
[581] [581] To measure the amount of lipid in the extracted material, a known amount of 17:0 TAG was added as an internal standard and the lipids from the known amount of seeds incubated in 1 N methanolic HCl-,
[582] [582] Content of canola oil and other seeds can also be measured by means of nuclear magnetic resonance techniques (Rossell and Pritchard, 1991), for example, by a pulsed wave NMS 100 Minispec (Bruker Pty Ltd Scientific Instruments, Germany) , or by near infrared as reflectance spectroscopy using a NIRSystems model 5000 monochromator. The NMR method can simultaneously measure the moisture content. Moisture content can also be measured in a sample of a seed lot by drying the seeds in the sample for 18 hours at about 100°C, according to Li et al., (2006).
[583] [583] Where fatty acid composition is to be determined for the oil in canola seeds, the direct methylation method used for Arabidopsis seeds (above) can be used, modified with the addition of cracking canola seed coats. This method extracts enough oil from the seed to allow analysis of the fatty acid composition. Lipid analysis from sheet lysate assays
[584] [584] The lipids from the lysate assays were extracted using chloroform:methanol:0.1 M KCl (2:1:1) and recovered. The different classes of lipids in the samples were separated on thin layer chromatography (TLC) plates on silica gel 60 (MERCK, Dernistadt, Germany), impregnated with 10% boric acid.
[585] [585] Tissues including foil samples were lyophilized, weighed (dry weight) and total lipids extracted as described by Bligh and Dyer (1959) or using chloroform: methanol: 0.1 M KCl (CMK, 2:1:1 ) as a solvent. Total lipids were extracted from N leaf samples.
[586] [586] Known volumes of total leaf extracts, eg 30 µL, were loaded onto a 60 (1X20 cm) plate silica gel TLC (Merck KGaA, Germany). Neutral lipids were separated by TLC in a balanced development tank containing a solvent system of hexane/DEE/acetic acid (70/30/1 respectively v/v/v). TAG bands were visualized by iodine vapor, scraped from the TLC plate, transferred to 2 ml GC vials and dried with N2. 750. µL of 1N methanolic HCl (Analytical Supelco, USA) was added to each vial, along with a known amount of C17:0 TAG, eg 30 µg, as an internal standard for quantification.
[587] [587]AO analyzing the effect on oleic acid levels of combinations of specific genes, TAG bands and polar lipids were collected from the TLC plates. Then, mg of C17:0 internal standard was added to the samples as TAG samples, polar lipid samples and 20 µ1 of the total lipid extracts. After drying under an atmosphere of N2, 70 µL of toluene and 700 µL of methanolic HCl were added.
[588] [588] Lipid samples for fatty acid composition analysis by GC were transmethylated by incubating the mixtures at 80°C for 2 hours in the presence of methanolic HCl. After cooling the samples to room temperature, the reaction was stopped by adding 350 µ1 of H2O. Fatty acyl methyl esters (FAME) were extracted from the mixture by addition of 350 µl of hexane, vortexing and centrifugation at 1700 rpm for 5 min. The upper hexane phase was collected and transferred to small GC flasks with 300 µ1 conical inserts. After evaporation, the samples were resuspended in 30 µ1 of hexane. A µ1 was injected into the GC.
[589] [589]The amount of individual and total fatty acids (TFA) present in the lipid fractions was quantified by GC by determining the area under each peak and calculated by comparing the peak area for a known amount of internal standard. Leaf TAG content was calculated as the sum of glycerol and fatty acyl fractions in the TAG fraction using a ratio: % TAG by weight, = 100x ((41x total mole FAME/3) + (total g FAME-(15x mole total FAME)))/9 dry sheet weight, where 41 and 15 are the molecular weights of the glycerol moiety and the methyl group, respectively. Gas-liquid capillary chromatography (GC)
[590] [590]FAME were analyzed by GC using an Agilent Technologies 7890A GC (Palo Alto, California, USA) equipped with a BPX70 SGE (70% cyanopropyl polysylphenylether.o-siloxane) column (30mx 0.25mm ID, 0 .25 µm film thickness), an FID, a split/splitless injector, and an Agilent Technologies 7693 Series autosampler and injector. Helium was used as a carrier gas. Samples were injected in split mode (50:1) at an oven temperature of 50°C. After injection, the furnace temperature was held at 150 °C for 1 min, then increased to 210 °C to 3 °C.rrlin"1 and finally to 240 °C to 50 °C.min-1. peaks were quantified with Agilent Technologíes ChernStation software (Rev B.04.03 (16), Palo Alto, California, USA) corr, based on the known quantity response of the external standard GLC-411 (Nucheck) and internal standard C17:0- Me. Quantification of TAG via Iatroscan
[591] [591] One µl of lipid extract was loaded onto a Chromarod-Sll by TLC-FID Iatroscan'" (Mitsubishi Chemical Medience Corporation - japan). The Chromarod rack was then transferred to a balanced development tank containing 70 ml of a system solvent hexane/CHClj2-propanol/formic acid (85/10.716/0.567/0.0567 v/V/V/V) After 30 min of incubation, the Chromarod rack was dried for 3 min at 100°C and immediately sorted into an Iatroscan MK-6S TLC-FID analyzer (Mitsubishi Chemical Medience Corporation - Japan) The internal standard and TAG DAGE peak areas were integrated using SIC-480II integration software (version:7.0-E SIC System Instruments Co.) ., LTD - japan).
[592] [592] TAG quantification was performed in two steps. First, DAGE was screened on all samples to correct for extraction yields, after which concentrated TAG samples were selected and diluted. Then, TAG was quantified in diluted samples with a second screening according to external calibration using glyceryl trilinoleate as external standard (Sigma-Aldrich). Quantification of TAG in leaf samples by GC
[593] [593] Individual FAME peak areas were first corrected, based on peak area responses of known amounts of the same FAMES present in a commercial GLC-411 standard (NU-CHEK PREP, Inc., USA). The corrected areas were used to calculate the mass of each FAME in the oyster against the internal standard. Since the oil is stored mainly in the form of TAG, the amount of oil was calculated based on the amount of FAME in each sample. Total moles of glycerol was determined by calculating moles of FAMEs and dividing total moles of FAMES by three. The amount of TAG was calculated as the sum of glycerol and fatty acid fractions using the formula: % oil by weight, = 100x ((41x total mole of FAME/3) + (total g of FAME-(15x total mole of FAME) )))/9 sheet dry weight, where 41 and 15 are the molecular weights of the glycerol fraction and the methyl group, respectively. DGAT Assay in Saccharomyces cerevisiae H1246
[594] [594] Saccharomyces cerevisiae strain H1246 is completely lacking DGAT activity and lacks TAG and sterol esters as a result of suppressed mutations in four genes (DGAI, LROI, AREI, ARE2). Addition of free fatty acids (eg, 1 mM 18:1a9) to the H1246 growth medium is toxic in the absence of DGAT activity. Growth on such a medium, therefore, can be used as an indicator or selection for the presence of DGAT activity in this yeast strain.
[595] [595]S. cerevisiae strain H1246 was transformed with the construct pYES2 (negative control), a construct encoding Arabidopsis thaliana DGATI in pYES2, or a construct encoding Mus musculus MGAT2 in pYES2. The transforms were fed [14C] 18:1A9 free fatty acids,
[596] [596] In a separate experiment, S. cerevisiae HI 246 was transformed with the construct pYES2 (negative control), a construct encoding Bernadia pulchella's DGATI in pYES2 or a construct encoding M. musculus MGATI in pYES2 and fed with [14C] 18:1^9 free fatty acids. The wild-type S288C strain of S. cerevisiae transformed with pYES2 served as a positive control.
[597] [597] The transformed yeasts were resuspended in sterile mQ water and diluted to OD600 = 1. Additional samples were diluted to four consecutive dilutions, each by 1/10. 2µl of each dilution were placed in each of the plates (YNBD, YNBG, YNBG+FA) together with 2µl mQ water 2µl of a suspension of untransformed H1246 cells (OD600 = 1). Plates were incubated for 6 days at 30°C before grading growth. Plate medium, 40 ml media per plate " YNBD: minimal drip medium deficient in uracil and containing 2% glucose, 0.01% NP40 and 100 µ1 ethanol.
[598] [598] The enzymatic activity of monoacylglycerol acyltransferase 1 (MGATI), encoded by the gene from M. musculus (Yen et al., 2002) and diacylglycerol acyltransferase (DGATI) from A. thaliana (Bouvier-Nave et al., 2000), used here as a comparison to MGATI, were demonstrated in N. benthamiana leaf tissue using a transient expression system as described in Example 1.
[599] [599] A vector designated 35S-pORE04 was constructed by inserting a Pstl fragment containing a 35S promoter into the Sfol site of the pORE04 vector after treatment with T4 DNA polymerase to make the ends unpointed (Coutu et al., 1- · .
[600] [600] The chimeric vectors have introduced into an AGLI strain of A. tumefaciens and the cells from cultures of these infiltrates into N. benthamiana leaf tissue planted in a growth room at 24°C. In order to allow direct comparisons between samples and to reduce inter-sheet variation, the samples being compared were infiltrated on both sides of the same sheet. Triplicate experiments were carried out. After infiltration, the plants were grown for a further three days before leaf discs were taken, lyophilized, and the lipids extracted from the samples were fractionated and quantified as described in Example 1. This analysis revealed that the MGATI and DGATI genes were working for increase N. benthamiana leaf oil levels as follows.
[601] [601] Leaf tissue transformed only with the construct 35S:p19 (negative control) contained an average of 4 µg free fatty acids (FFA) derived from DAG/mg leaf dry weight and µg FFA derived from TAG/mg of dry sheet weight. Leaf tissue transformed with the constructs 35S:p19 and 35S:DGAT1 (control for DGATI expression) contained an average of 4 µg FFA, derived from DAG/mg dry leaf weight, and 22 µg FFA derived from TAG/mg of dry leaf weight. Leaf tissue transformed with the 35S:p19 and 35S:MGAT1 constructs contained an average of 8 µg DAG-derived FFA/rr.g leaf dry weight and 44 µg TAG-derived FFA/mg leaf dry weight. Leaf tissue transformed with the 35S:p19, 35S:DGAT1 and 35S:MGAT1 constructs did not contain higher levels of Dilg or TAG than those observed in the 35S:p19 and 35S:MGAT1 infiltrate (Fig. 2). Also, a decrease in the level of saturated fatty acids in seeds was observed after MGAT expression when compared with p19 control or DGATI samples (Table 2).
[602] [602] The data described above demonstrated that the MGAT 1 enzyme was much more active than the DGATI enzyme in promoting the accumulation of DAG and TAG in leaf tissue. The gene expression
[603] [603] Leaf samples infiltrated with M. musculus MGATI accumulated twice as much DAG and TAG compared to leaf tissue infiltrated solely with A. thaliana DGATI. The efficiency of TAG production was also surprising and unexpected, given that mouse MGAT has very little activity like DGAT. Leaf tissue infiltrated with genes encoding MGATI and DGATI did not accumulate significantly more TAG than MGAT 1 - leaf sample alone. Figure 1 is a representation of various TAG accumulation pathways, many of which converge on DAG, a key molecule in lioid synthesis. For example, MAG, DAG and TAG can be interconverted through various enzymatic activities, including transacylation, lipase, MGAT, DGAT and PDAT. A decrease in the level of saturated fatty acids was also observed after MGAT expression.
[604] [604] A chimeric DNA designated 35S:MGAT2 and encoding the M. musculus MGAT2 for expression in plant cells was constructed by inserting the entire MGAT2 coding region, contained in an ECORI fragment, into 35S- porE04 on the ecori site. The enzymatic activity of monoacylglycerol acyltransferase 2 (MGAT2), encoded by the gene of M. musculus (Yen, 2003) (Genbank Accession No. Q80W94) and of the DGATI of A. thaliana (DGATI) (Bouvier-Nave et al. ., 2000), used here as a comparison to MGAT2, have also been demonstrated in N. benthamiana leaf tissue using a transient expression system, as described in Example 1.
[605] [605] Compared to controls, DGATI expression increased leaf TAG by 5.9-fold, MGAT2 by 7.3-fold and the combination of MGAT2+DGAT1 by 9.8-fold (Figure 3). The ability of MGAT2 alone to produce such significant increases in TAG was unexpected for a number of reasons. First, the amount of MAG substrate present in the sheet fabric is known to be low and large increases in TAG accumulation from this substrate would not be expected. Second, the addition of MGAT activity alone (ie, addition of MGAT2 that has no DGAT activity) would be expected to produce DAG, not TAG, especially in a leaf environment where little native DGAT activity is generally present.
[606] [606]The present inventors have surprisingly demonstrated that transgenic expression of an MGAT gene results in significant increases in lipid production in plant cells. The present inventors understand that Tumaney et al. had isolated a DGAT with some MGAT activity and that they were not successful in trying to clone a gene that codes for an MGAT as defined here. Tumaney et al.
[607] [607] Recently, researchers identified a microsomal membrane-bound monoacylglycerol acyltransferase (MGAT) from immature peanut seeds (Arachis hypogaea). MGAT can be solubilized from microsomal membranes using a combination of a chaotropic agent and a detergent
[608] [608] Cell lysates were made from N. benthamiana leaf tissue that had been infiltrated with 35S:MGAT1, 35S:MGAT2 and 35S:DGAT1, as described in Example 1. Separate leaf infiltrations were performed each in triplicate, for strains containing only the 35S:p19 construct (negative control), the 35S:MGAT2 strain together with the .
[609] [609] Little MGAT activity was observed in the 35S:p19 control sample, but most of the radioactivity remained in the MAG throughout the assay. In contrast, most of the MAG tagged in the 35S:MGAT2 sample was rapidly converted to DAG (Figure 4, center panel), which indicates strong MGAT activity expressed from the 35S:MGAT2 construct. In addition, a significant amount of TAG was also produced. The TAG production observed in the 35S:MGAT2 sample was probably due to the activity of DGAT native to N. benthamiana, or produced by another TAG synthesis pathway. The amount of TAG production was considerably increased by the further addition of 35S:DGAT1 (Figure 4, right side panel), indicating that the MGAT2 enzyme produced DAG which was accessible for conversion to
[610] [610] In the in vitro assays described in Example 3 using leaf lysates, substrates (sn-2 MAG and oleoyl-CoA) were supplied exogenously, whereas the in vivo activity of MGAT in intact plant tissues would require the native presence of these substrates. The presence of low levels of MAG in various plant tissues has been previously reported (Hirayama and Hujii, 1965; Panekina et al., 1978; Lakshminarayana et al., 1984; Perry & Harwood, 1993). To test whether MGAT2 could access MAG produced by native plant routes, the above experiment was repeated, but this time feeding [14C]G-3-P to the lysates. The resulting data are shown schematically in Figure 5. . [611] Labeled MAG production was observed in all samples, indicating de novo MAG production from G-3-P in plant leaf lysates. Labeled DAG and TAG products were also observed in all samples, although these were relatively low in the sample. of 35S:p19 control, indicating that the production of these neutral lipids by the endogenous Kennedy route was relatively low in this sample. In contrast, most of the r-marking MGAT2 and MGAT2 + DGATI samples appeared in the DAG and TAG groups, suggesting that the exogenously added MGAT catalyzed the conversion of the MAG that had been produced from the G- 3-P marked by a native plant route.
[612] [612] Examples 2 to 4 demonstrate several key points: 1) Leaf tissue can synthesize MAG from G-3-P, such that MAG is accessible to an exogenous MGAT expressed in leaf tissue; 2) Even an MGAT that is derived from the intestine of mammals can function in plant tissues, not known to have an endogenous MGAT, requiring a successful interaction with other plant factors involved in the synthesis of
[613] [613] Chimeric yeast expression vectors were constructed through the insertion of genes encoding DGATI from A. thaliana, MGATI from M. musculus and MGAT2 from M.
[614] [614] TAG formation, indicating the presence of DGAT activity, was observed for yeast cells containing any DGATI (positive control) and mammalian MGATI, but not in cells containing the MGAT2 encoded by the M coding region .native musculus. It was concluded that mouse MGATI also had DGAT activity in yeast cells and therefore functioned as a dual-function MGAT/DGAT enzyme, whereas MGAT2 has no detectable DGAT activity and therefore only MGAT. A construct that includes an MGAT2 coding region that was codon-optimized for expression in yeast showed MGAT (DAG production) activity when tested in vitro using yeast p substrate microsomes
[615] [615] A gene encoding M. musculus MGATI and under the control of a seed-specific promoter (FPl, a truncated promoter from Brassica napus napin) was used to generate stable transformed A. thaliana plants and ,, seeds , offspring. The vector designated pjP3174 was made by inserting a SalI fragment containing an Ecori " site flanked by the Fpl promoter and the Glicine max lectin polyadenylation signal into the SalI-Xhol site of vector pCW141. The vector from pCW141 also contained a Seed secreted GFP, targeted to FP1, interrupted by intron, as a screening marker gene. The chimeric gene designated FPI:MGATI-GFP was made by inserting the entire coding region of the 0954364_MGAT_pMA construct, contained in an ECOKL fragment , in pjP3174, at the ECoRI site, generating pjP3179. This chimeric vector was introduced into A. tumefaciens AGL 1 strain and transformed Agrobacterium culture cells used to treat A. thaliana plants (Columbia ecotype) using the floral dip method for transformation (Clough and Bent, 1998).
[616] [616] This analysis revealed that the MGATI gene was functioning to increase seed oil levels in A. thaliana seeds with fifteen non-transgenic seeds (control, same as wild type) containing an average of 69.4 µg of total fatty acids while the fifteen transgenic seeds transformed with the GFP gene and therefore likely to contain the genetic construct FPI:MGATI, contained an average of 71.9 µg total fatty acids. This was a 3.5% increase in oil content over the control (wild type ..m type). The analysis also revealed that the dp MGAT gene was functioning to enrich the polyunsaturated fatty acids in the seed, as can be seen from the fatty acid corruption of the extracted total lipids obtained from the seeds. In particular, the amount of ALA present, as a percentage of the total fatty acid extracted from the seeds, increased from 16.0 pQ to 19.6%. Likewise, the percentage of the 20:2ntj fatty acid increased from 1.25% to 1.90% and the 20:3n3 fatty acid increased by 0.26% to 0.51% (Table 2). Table 2. Effect of the expression of MGAT on the Pomposí tion of fatty acids from the seed.
[617] [617] A new experiment was performed where the FPI:MGATI-GFP chimeric DNA was modified to remove the GFP gene. This genetic construct, designated FP1:MGATI was transformed into an A. thaliiana line that was mutant for FAD2. The total fatty acid content of the T2 seed of antibiotic resistant T1 plants, as well as the parental lines grown alongside these plants, was determined according to Example 1. The data are shown in Table 3. The mean of total fatty acids of the seed from the control lines was 347.9 µg/1OO seeds, whereas the mean of the transgenic seeds was 381.0 µ"g/1'OO seeds. When the data for the C6 control line was,,, Excluded for the determination of the mean, the mean for the controls was 370 µg/100% seeds.The oil content in the transgenic seeds represented an increase of about 3% in relative terms, compared to the oil content in the non-transformed seeds.
[618] [618] The codon-optimized mouse MGAT2 gene coding region for expression in plant cells was substituted for the MGATI coding region in the above constructs, and introduced into Arabidopsis.
[619] [619]0 FP1:MGAT1 vector used for the MGATI expression of
[620] [620] The co-cultured explants (cotyledonary petiole and hypocotyl) were then washed with sterile distilled water + 50mg/L cefotaxime + 50 mg/L timentin for 10 minutes, rinsed in sterile distilled water for 10 minutes, dried on sterile filter paper, transferred to pre-selection medium (MS + 1 mg/L of TDZ + 0.1 mg/L of NAA + 20 mg/L of adenine sulfate (ADS) + 1 .5 mg/L of
[621] [621] The same chimeric seed-specific gene used for the expression of M. musculus MGATI in Arabidopsis thaliana seeds was used to generate transformed plants of Gossypium hirsutum. The vector designated FPI:MGATI was introduced into A. tumefaciens AGLI strain via standard electroporation procedures and cells from Agrobacterium cultures used to introduce the chimeric DNAS into cells of Gossypium hirsutum, variety Coker315. Cotyledons excised from 10-day-old cotton plants were used as explants and infected and co-cultured with A. tumefaciens for a period of two days. This was followed by a six-week selection on MS medium (Murashige and Skoog, 1962) containing 0.1 ng/L 2,4-D, 0.1 mg/L quinetin, 50 mg/L kanamycin sulfate and 25 mg/L of cefotaxirn. Healthy stems derived from cotyledonous explants were transferred to MS medium containing 5 mg/L 6-(Y,Y-dimethylallylamino)-purine (2ip), 0.1 mg/L naphthaleneacetic acid (NAA), 25 mg/L of Panamycin and 250 mg/L of cefotaxime for a second period of six weeks at 28°C. Somatic embryos that formed after six to ten weeks of incubation were germinated and kept in the same medium, but without the addition of phytohormones or antibiotics. Seedlings developed from somnitic embryos were transferred to the soil and kept in a greenhouse once the leaves and roots were developed, with a growth temperature of 28°C/20°C (day/night). Ten independent primary transgenic (TO) plants containing the fp1-mgat1 construct were cultivated in a greenhouse, flowered and produced capsules containing seeds. Seeds were harvested at maturity. To improve the reliability of the oil content analysis, 5 plants were established from each of the 10 primary transgenic plants and the mature T2 seeds are subjected to oil content analysis. Seed-specific expression of MGATI increases the oil content and increases the percentage of polyunsaturated fatty acids in cottonseed oil.
[622] [622]N. benthamiana was stably transformed with the 35S:MGAT1 construct described in Example 2. 35S:MGAT1 was introduced into the AGLI strain of A. tumefaciens by standard electroporation procedure. Transformed cells were grown in solid LB medium supplemented with kanamycin (50 mg/L) and rifampicin (25 mg/L) and incubated at 28°C for two days. A single colony was used to start the fresh culture. After 48 hours of vigorous culture, cells were collected by centrifugation at 2000 x g and the supernatant discarded. Cells were resuspended in fresh solution containing 50% LB medium and 50% MS medium at density OD600=0.5.
[623] [623] In vitro cultured N. benthamiana leaf samples were extirpated and squared in sections about 0.5 to 1 cm2 in size with a sharp scalpel while immersed in the A. tumefaciens solution. The wounded N. benthamiana leaf pieces submerged in A. tumefaciens were left at room temperature for 10 minutes before being broken up in sterile filter paper and transferred to MS plates without supplement. After a co-cultivation period of two days at 24°C, the explants were washed three times with sterile liquid MS medium, then cut up with sterile filter paper and placed on selective MS agar supplemented with 1.0 mg/L of benzylaminopurine (BAP), 0.25 mg/L of indoleacetic (IAA), 50 mg/L of kanamycin and 250 mg/L of cefotaxime. The plates were incubated at 24°C for two weeks allowing the development of shoots from the transformed leaf pieces of N. benthamiana.
[624] [624] To establish transgenic rooted plants in vitro, healthy green shoots were cut and transferred into 200 mL tissue culture pots containing MS agar supplemented with 25 µg/L IAA, 50 mg/L cannamibin and 250 rng/L of cefotaxime. Sufficiently large leaf discs were taken from transgenic shoots and lyophilized for TAG fractionation and quantification, as described in Example 1 (Table 5). The best 35s:MgijT1 N. benthamiana plant had a TAG content of 204.85 µg/100 mg of leaf tissue dry weight compared to an average TAG content of 85.02 µg/1OO mg of dry weight of the leaf in! control lines, which represents an increase in TAGl content of 24i·%.
[625] [625] N. benthamiana was also stably transformed with the construct 35S:MGAT2 described in Example 2 and ccjm a binary control vector pORE4 (Table 6). The best 35S:MGAT2 plant from N. benthamiana had a TAG content of 79.0 µg/10O mg leaf tissue dry weight compared to a TAG content of 9.5 µg/100 mg weight leaf dry in the control line at the same stage of development, which represents an increase in TAG content of 731%. The fatty acid profile of the TAG fractions was also altered with significantly reduced levels of 16:0 and 18:¢ saturated fatty acids and increased levels of polyunsaturated fatty acids, especially 18:3o3 (ALA) (Table 6). The fatty acid profile of the polar lipids of the same leaf samples was not significantly affected, indicating that the changes in the fatty acid composition of the non-polar lipids were real. The 3 control plants in this experiment were smaller C physiologically different than in the previous experiment with O)| censtructo 35S:FÍGAT1, and that may have explained the different Gonteúdo of ! l plant oil control from one experiment to the other.
[626] [626]A new set of binary constitutive expression vectors was made using a 35S promoter with a duplicated enhancer region (e35S). 35S:MGAT1 #2 (pjP3346), 35S:MGAT2 #2 (pjP3347) and 35S:DGAT1 #2 (pjP3352) were made by first cloning the e35S promoter, contained within a BamHI-EcoRI fragment, nc: porE04 into the BamHI- sites EcoRI to produce pjP3343. pjp3346 and pjP3347 then were produced by cloning the MGATI and MGAT2 genes, respectively, into the Ecori site of pjP3343.
[627] [627] pjP3346, pjP3347 and pjP3352 in Agrobacterium AGLI strain were used to transform N. benthamiana as described above. Fourteen confirmed transgenic plants were recovered for pjP3346 and 22 for pjP33417. A number of kanamycin resistant, transformed shoots were generated with pjP3352. Analysis of the expression of trans genes was performed in plants transformed with MGATI or MGAT2. Piantas with high expression levels were selected. Expression analysis of plants transformed with A. thaliana DGAT DGATI is performed. Plants grow normally and are grown to maturity. The seed is harvested when it is ripe. Seeds of high-expressing offspring are sown directly into the soil for lipid analysis of the population segregating T2, which includes homozygous and heterozygous plants. The oil content of the leaves of plants expressing high levels of MGATI or MGAT2 is significantly higher compared to plants transformed with DGATI from A. thaliana or control plants. MGAT2 transgenic plants showed a significant increase in 18:1 and 1 °5 unsaturated fatty acid relative to the increase in total fatty acid content compared to null events (Table 7).
[628] [628]pjP3346, pjP3347 and a control vector in AGLI were also used to transform A. thaliana, as described above. Twenty-five confirmed T2 transgenic plants comprising the T-DNA of pjP3346 and 43 transgenic plants for pjP3347 were identified. Expression analysis was performed on transgenic plants. Seeds of high-expressing offspring were collected and sown directly into the ground. Lipid analysis was carried out, including the oil content of the leaves of the T2 and T3 progeny, including the deficient segregants of the trans genes. The highest levels of TAG were obtained in plants that are homozygous for the MGAT transgenes.
[629] [629] Thirty plants from each transgenic line were grown in a random arrangement in the study with the parental control plants. T2 seeds were analyzed for oil content and showed an increase of about 2% in oil content (total fatty acid level) compared to the total fatty acid content of parent seeds (Figure 8).
[630] [630] A chimeric gene encoding M. musculus MGATI was used to transform Trifolium repens, another dicotyledonous plant. Vectors containing the 35S:MGAT1 and 35S:DGAT1 chimeric genes were introduced into A. tumefaciens through a standard electroporation procedure. Both vectors also contain a 35S:BAR selection marker gene. Transformed Agrobacterium cells were grown in solid LB medium supplemented with kanamycin (50 mg/L) and rifampicin (25 mg/L) and incubated at 28°C for two days. A single colony was used to start a fresh culture for each construct. After vigorous culture for 48 hours, Agrobacterium cultures were used to treat cotyledons of T. repens (cv. Haifa) that had been dissected from soaked seeds as described by Larkin et al. (1996). Co-cultured for the following three days, explants were exposed to 5 mg/L PPT to select for transformed shoots and then transferred to rooting medium to form roots, prior to transfer to soil. A transformed plant containing MGATI was obtained. The 35S promoter is constitutively expressed in transformed plant cells. The oil content is increased at least in vegetative tissues such as leaves.
[631] [631] A chimeric vector including M. musculus MGATI was used to produce the stable transformation of Hordeum vulgare, a monocotyledonous plant. Vectors containing the chimeric genes Ubi:MGAT1 and Ubi:DGAT1 were constructed by cloning the entire M. musculus MGATI and A. thaliana DGATI coding regions separately into pwVEC8-Ubi. Vectors containing the chimeric genes Ubi:MGAT1 and Ubi:DGAT1 were introduced into AGLI strain of A. tumefaciens through standard electroporation procedure. Transformed Agrobacterium cells were grown in solid LB medium supplemented with kanamycin (50 mg/L) and rifampicin (25 mg/L) and the plates incubated at 28°C for two days. A single colony of each was used to start fresh cultures.
[632] [632] After vigorous culture for 48 hours, Agrobacterium cultures were used to transform cells from immature barley embryos {cv. Golden Promise) according to published methods (Tingay et al., 1997; Bartlett et al., 2008) with some modifications. Briefly, embryos between 1.5 and 2.5 mm in length were isolated from immature caryopsis and the embryonic axes removed. The resulting explants were co-cultured for 2-3 days with the transgenic Agrobacterium and then grown in the dark for 4-6 weeks in channels containing the timentin and hygromycin to generate embryogenic callus before being moved to transitional media under conditions of low light for two weeks. The callus was then transferred to regeneration medium to allow for the regeneration of shoots and roots, prior to transfer to soil. Transformed plants were obtained and transferred to the greenhouse. The MGATI coding region was constitutively expressed under the control of the Ubi promoter in cells from transformed plants. Transgenic plants were generated and their tissues analyzed for oil content. Due to the low number of transgenic events in a first transformation, no statistically significant conclusions could be drawn from the data.
[633] [633] The coding region of the mouse MGAT2 gene, codon-optimized for expression in plant cells, is substituted for MGATI in the constructs mentioned above and introduced into Hordeum as described above. Vegetative tissues of the resulting transgenic plants are increased in oil content. MGAT expression in yeast cells
[634] [634]A chimeric vector including M. musculus MGATI was used to transform yeast, in this example Saccharomyces cerevisiae, a fungal microbe suitable for oil production by fermentation. A Gall:MGATI genetic construct was made by inserting the entire coding region of a construct designated 0954364 MGAT_pMA, contained in an —-fragment of EcoRI, into pYES2 at the Ecori site, generating pjP3301. Likewise, a Gal1:DGAT1 genetic construct, used here as a comparison and separately coding for the DGATI enzyme of A.
[635] [635] The coding region of the mouse MGAT2 gene, codon-optimized for expression in yeast cells, is substituted for MGATI in the aforementioned constructs and introduced into yeast. The resulting transgenic cells are increased in oil content. The genes are also introduced into the oleaginous yeast, Yarrowia lipolytica, to increase the oil content.
[636] [636] A chimeric vector including M. inusculus MGATI is used to stably transform algal cells. The genetic constructs designated 35S:MGAT1 made by cloning the coding region for MGATI into a cloning vector containing a cauliflower mosaic virus 35S promoter cassette and a paramomycin resistance gene (aminoglycoside-O-phosphotransferase VIII) expressed by a RBCS2 promoter from C. reinhardtii. 35S:MGAT1 is separately introduced into a logarithmic culture of 5x107cc503, a cell wall deficient strain of Chlamydomonas reinhardtii by a modified glass bead method (Kindle, 1990). Both vectors also contain the BLE resistance gene as a selection marker gene. Briefly, a colony of untransformed cells on a TAP agar plate maintained at about 24°C is grown to about 5x106 cells/ml for four days, the resulting cells are precipitated at 3000g for 3 minutes at room temperature. and resuspended to produce 5x107 cells in 300 µl of TAP medium. 300 μl of 0.6 mm diameter glass beads, 0.6 μg plasmid in 5 μl and 100 μl 20% PEG MW8000 are added and the mixture is vortexed at full speed for 30 seconds, then transferred to 10 μl of TAP and incubated for 16 hours with shaking in the dark. The cells are precipitated, resuspended in 200 µL of TAP, then plated on TAP plates containing 5 mg/L of zeocin and incubated in the dark for 3 weeks. Transformed colonies are plated with fresh TAP + 5 mg/L zeocin, after which they are grown under standard medium conditions with zeocin selection. Once harvested by centrifugation, cell pellets are washed with water before being lyophilized for lipid types fractionation and quantification analysis as described in Example 1. The 35S:MGAT1 promoter is constitutively expressed in transformed algal cells . The oil content of cells is significantly higher.
[637] [637] The coding region of the mouse MGAT2 gene, codon-optimized for expression in plant cells, is substituted for MGATI in the above-mentioned constructs and introduced into Chlamydomonas. The oil content of the resulting transgenic cells is significantly higher. MGAT expression in stably transformed Lupinus angustifolius
[638] [638]The chimeric vector including M. musculus MGATI is used to transform Lupinus angustifolius, a legume plant. Chimeric 35S:MGAT1 and 35S:DAGATI vectors in Agrobacterium are used to transform L. angustifolius as described by Pigeaire et al. (1997). Briefly, bud apex explants are co-cultured with transgenic Agrobacterium before being thoroughly wetted with PPT solution (2 mg/ml) and transferred to PPT-free regeneration medium. Multiple axillary shoots developed from shoot apexes are extirpated in a medium containing 20 mg/L PPT and the surviving shoots transferred to fresh medium containing 20 mg/L PPT. Healthy shoots are then transferred to the soil. The 35S promoter is constitutively expressed in transformed plant cells, increasing the oil content in vegetative tissues and seeds. A seed-specific promoter is used to increase the oil content in transgenic Lupinus seeds.
[639] [639] The coding region of the mouse MGAT2 gene, codon-optimized for expression in plant cells, is substituted for MGATI in the constructs mentioned above and introduced into Lupinus. Seeds and vegetative tissues of the resulting transgrain plants are increased in oil content.
[640] [640] A chimeric vector including M. musculus MGATI is used to stably transform Sorghum bicolor. Ubi:MGAT1 and Ubi:DGAT1 in AGLI strain of A. tumefaciens are used to transform Sorghum bicolor as described by Gurel et al. (2009). The Agrobacterium is first centrifuged at 5,000 rpm at 4°C for 5 minutes and diluted to OD55C = 0.4 with liquid co-culture medium. Previously isolated immature embryos are then covered completely with the Agrobacterium suspension for minutes and then cultured, scutellum side up, in the co-culture medium in the dark for 2 days at 24°C. The immature embryos are then transferred to callus induction medium (CIM) with 100 mg/L carbenicillin to inhibit Agrobacterium growth and leave for 4 weeks. Tissues are then transferred to regeneration medium for shoots and root.
[641] [641] The coding region of the mouse MGAT2 gene, codon-optimized for expression in plant cells, is substituted for MGATI in the constructs mentioned above and introduced into Sorghum. Vegetative tissues of the resulting transgenic plants are increased in oil content.
[642] [642] A chimeric gene encoding MGATI from M.
[643] [643] The coding region of the mouse MGAT2 gene, codon-optimized for expression in plant cells, is substituted for MGATI in the aforementioned constructs and introduced into Glycine. Seeds and vegetative tissues of the resulting transgenic plants are increased in oil content. MGAT expression in Zea mays stably transformed
[644] [644] A chimeric gene encoding M. musculus MGATI is used for the stable transformation of Zea mays. Vectors including 35S:MGAT1 and 35S:DGAT1 are used to transform Zea mays as described by Gould et al. (1991).
[645] [645] The coding region of the mouse MGAT2 gene, codon-optimized for expression in plant cells, is substituted for MGATI in the constructs mentioned above and introduced into Zea mays. Seeds and vegetative tissues of the resulting transgenic plants are increased in oil content. Alternatively, the MGAT coding regions are expressed under the control of an endosperm-specific promoter such as the zein promoter, or an embryo-specific promoter obtained from a monocotyledonous plant, for increased expression and for increased oil content in seeds. Another chimeric gene encoding a GPAT with Eosphatase activity, such as GPAT4 or GPAT6 from A. thaliana, is introduced into Zea mays in combination with MGAT, further increasing the oil content in maize seeds.
[646] [646] A chimeric gene encoding M. musculus MGATI is used for the stable transformation of Elaeis guineensis. Chimeric vectors designated Ubi:MGAT1 and Ubi:DGAT1 in Agrobacterium are used. After vigorous 48-hour culture, the cells are used to transform Elaeis guineensis, as described by Izawati et al. (2009).. The Ubi promoter is constitutively expressed in cells of transformed plants, increasing the oil content at least in fruits and seeds and can be used to obtain oil.
[647] [647] The coding region of the mouse MGAT2 gene, codon-optimized for expression in plant cells, is substituted for MGATI in the constructs mentioned above and introduced into Elaeis. Seeds from the resulting transgenic plants are increased in oil content. MGAT expression in stably transformed Avena sativa (oats)
[648] [648] A chimeric gene encoding j'q MGATI. musculus is used to stably transform Avena sativa, another monocotyledonous plant. Chimeric vectors designated Ubi:MGAT1 and Ubi:DGAT1, as described above, and both containing a Ubi:BAR selection marker, are used to transform the
[649] [649] The coding region of the mouse MGAT2 gene, codon-optimized for expression in plant cells, is substituted for MGATI in the constructs mentioned above and introduced into Avena. Seeds from the resulting transgenic plants are increased in oil content. Example 7: Design of an MGAT with DGAT activity
[650] [650] An MGAT with altered DGAT activity, especially increased DGAT activity and potentially increased MGAT activity can be designed to perform random mutagenesis, targeted mutagenesis or saturation mutagenesis on the MGAT gene(s) of interest or by subjecting different MGAT genes and /or DGAT to DNA scrambling. The DGAT function can be positively selected using, for example, a yeast strain that has an absolute requirement for TAG synthesis complementation when fed with free fatty acids such as strain H1246 which contains mutations in the four genes (DGAI, LROI, AREI, ARE2 ). Transforming the MGAT variants into such a strain and then providing the transformed yeast with a concentration of free fatty acids that prevents complementation by the wild-type MGAT gene will only allow the growth of variants with greater capacity for TAG synthesis due to the enhanced DGAT activity . The MGAT activity of these mutant genes can be determined by feeding tagged MAG sn-1 or sn-2 and quantifying the production of tagged DAG. Several rounds of directed evolution in combination with rational protein design would result in the production of a new MGAT gene with MGAT activities. DGAT similar.
[651] [651] The gene encoding the MGATI acyltransferase from M.
[652] [652]The entire MGATI coding region of selected clones is sequenced to identify the number of original mutants and to identify the nature of the selected mutations. Single MGATI mutants are retransformed into S. cerevisiae H1246 for in vitro DGAT and MGAT assays using labeled MAG and C18:1 substrates, respectively (see Example 5). Selected MGATI variants have been shown to exhibit increased DGAT activity compared to wild-type acyltransferase, while MGAT activity is possibly also increased.
[653] [653]MGATI variants exhibiting increased MGAT and/or DGAT activities are used as relatives in a DNA scrambling reaction. The resulting library was subjected to a selection system similar to the one described above, resulting in improvement in overall acyltransferase activity. In addition, free fatty acids other than C18:1 are added to the growth medium to screen for MGATI variants exhibiting altered acyl donor specificities.
[654] [654] Expression of A. thaliana DGAT2 in yeast cells (Weselake et al., 2009) and in insect cells (Lardizabal et al., 2001) did not demonstrate DgjíT activity. Likewise, DGAT2 was not able to complement a suppressed A. thaliana DÇATI (Weselake et al., 2009). the enzymatic activity of A. thaliana DGAT2 in leaf tissue was determined using an N-transient expression system.
[655] [655] Leaf tissue transformed with the construct 35S:p19 (control-negative) contained an average of 25 µg TAG/1OO leaf dry weight. Leaf tissue transformed with 35S:pI9 and 35S:DGAT1 constructs (positive control) contained an average of 241 µg TAG/100 mg leaf dry weight. Leaf tissue transformed with 35S:pI9 and 35S:DGAT2 constructs contained an average of 515 µg TAG/100 mg leaf dry weight.
[656] [656] The data described above demonstrate that the A. thaliana DGAT2 enzyme is more active than the A. thaliana DGATI enzyme in promoting the accumulation of TAG in the leaf tissue. Exoression of the DGAT2 gene resulted in 229% more accumulation of TAG in leaf tissue compared to when the amount of overexpressed DGATI TAG was set to 100% relative (Figure 9).
[657] [657]Transiently transformed N. benthamiana leaf tissues expressing isolated P19 (control), or P19 with AtDGAT1 or AtDGAT2 were also used to prepare microsomes for in vitro assays of enzyme activity. A DGAT biochemical assay was performed using microsomes corresponding to 50 µg of protein and addition of 10 nmol of
[14] [14]C6:0-DAG and 5 nmoles acyl-CoA, in 50 mM Hepes buffer, pH 7.2, containing 5 mM MgCl2, and 1% BSA, in a final volume of 100 µL for each assay. Assays were conducted at 30°C for 30 minutes. Total lipid from each assay was extracted and samples loaded onto TLC plates, which were developed using a hexane:DEE:Hac (70:30:1 vol:vol:vol) solvent mixture. The amount of radioactivity in DAG and TAG spots was quantified by Phosphorlmage measurement. The percentage of DAG converted to TAG was calculated for each of the microsome preparations.
[658] [658]Some endogenous DGAT activity was detected in N. benthamiana leaves, as the P19 control assay showed low levels of TAG production. The expression of AtDGAT1 generated greater DGAT activity compared to the P19 control when the assays were supplemented with C18:1-CoA O'-1 C18:2-COA, ma," not when supplemented with C18:3-COA, in which the TAG levels for the P19 control and AtDGAT1 were similar, however, in all microsomal assays when AtDGAT2 was expressed in leaf tissues, higher levels of DGAT activity (TAG production) were observed compared to those found AtDGAT1 microsomes Higher levels of TAG production were observed when the microsomes were supplemented with C18:2-COA or C18:3-CoA over C18:1-CoA (Figure 10) This indicated that DGAT2 had a different substrate preference , in particular for C18:3-COA (ALA), from DGATI.
[659] [659] Yang et al. (2010) described two glycerol-3-phosphate acyltransferases (GPAT4 and GPAT6) from A. thaliana both with a preference for sn-2 (ie, preferentially forming MAG,sn-2, rather than MAG sn-1/3) and phosphatase activity, which were able to produce sn-2 MAG from G-3-P (Figure 1). These enzymes have been proposed to be part of the metabolic pathway of cutin synthesis. GPAT4 and GPAT6 did not have a high expression in seed tissue. The combination of such a GPAT/bifunctional phosphatase with MGAT generates a new route of DAG synthesis using G-3-P as a substrate that can substitute for complementing the typical Kennedy route for DAG synthesis in plants, especially in oilseeds. , or in other cells, which results in increased oil content, in particular TAG levels.
[660] [660] Chimeric DNAs designated pjP3382 and pjP3383, which code for A. thaliana GPAT4 and GPAT6, respectively, together with M. musculus MGAT2 for plant seed emergence, were constructed by first inserting the entire MGAT2 coding region , contained in a Swal fragment, in pjP3362 at the Smal site to produce pjP3378. pjP3362 was a binary expression vector containing FAEI and
[661] [661] The coding region of the meat MGAT2 gene, codons optimized for expression in plant cells, was introduced into Brassica napus, along with a chimeric gene that codifies Arabidopsis GPAT4. The resulting transgenic plant seeds were collected and some were analyzed. Data from these preliminary analyzes showed variability in oil content and fatty acid composition, probably due to the plants growing at different times and under different environmental conditions. Seeds are planted to produce offspring plants, and offspring seeds are harvested. Example 1C): Evaluation of the ect,o_de_G,PAT,4 and GpAT£_ngj .aume,n,t,o, of mediated TAG LEor MGAT = e10 gpat silencing and mutation
[662] [662]The GPAT family is large and all known members contain two conserved domains, a plsC acyltransferase domain and a hydrolase domain similar to HAD. In addition to this, GPAT4-8 from A. thaliana all contain an N-terminal region homologous to a phosphoserine phosphatase domain. The A. thaliana GPAT4 and GPAT6 both contain conserved residues that are known to be essential for phosphatase activity (Yang et al., 2010).
[663] [663] Degenerate primers based on the conserved amino acid sequence GDLVICPEGTTCREP (SEQ ID NO:228) were designed to amplify fragments of N. benthamiana GPA1's expressed in leaf tissue. 3' RACE will be performed using these oligo-dT primers and reverse primers on RNA isolated from N. benthamiana leaf tissue. GPATS with phosphatase activity (ie, GPAT4/6-like) will be identified by their homology to the N-terminal domain region of phosphoserine phosphatase described above. The 35S-directed RNA1 constructs that are targets of these genes will be generated and transformed into the AGLI strain of A. tumefaciens. Likewise, a 35S:V2 construct containing the viral V2 silencing suppressor protein will be transformed into the AGLI strain of A. tumefaciens. V2 is known to suppress the native plant silencing mechanism to allow expression
[664] [664] TAG accumulation will then be compared between transiently transformed leaf samples infiltrated with the following strain mixtures: 1) 35S:V2 (negative control); 2) 35S:V2 + 35S:MGAT2 (positive control); 3) 35S:V2 + GPAT-RNA1; 4) 35S:V2 + GPAT-RNA1 and 35S:MGAT2. It is expected that the 35S:V2 + GPAT-RNA1 + 35S:MGAT2 mixture will result in less TAG accumulation than the 35S:V2 + 35S:MGAT2 sample due to disruption of sn-2 MAG synthesis resulting from GPAT silencing.
[665] [665]A similar experiment will be performed using sequences similar to GPAT 4/6 of a. thaliana and n. benthamiana that are mutated to remove the conserved residues that are known to be essential for phosphatase activity (Yang et al., 2010). These mutated genes (known collectively as GPAT4/6-delta) will be cloned into 35S-directed binary expression vectors and will then be transformed into A. tumefaciens. TAG accumulation will then be compared between transiently transformed leaf samples infiltrated with the following strain mixtures: 1) 35S:p19 (negative control); 2) 35S:p19 + 35S:MGAT2 (Elositive control); 3) 35S:p19 + GPAT4/6-de1ta; 4) 35S:p19+ GPAT4/6Ldelta + 35S:MGAT2. It is expected that the 35S:pI9 + GPAT4/G-delta + 35S:MGAT2 mixture will result in less TAG accumulation than the 35S:p19 + 35S:MGAT2 sample due to disruption of sn-2 MAG synthesis resulting from the GPAT mutation . While the GPZT4/6-like native genes of N. benthamiana will be present in this experiment, it is expected that the high-level expression of the GPAT4/6-delta constructs will compete with the endogenous genes to access the G-3 substrate -FOR.
[666] [666] A vector designated 35S-pORE04 was prepared by inserting a Pstl fragment containing a 35S promoter into the Sfol site of vector pORE04 after treatment with T4 DNA polymerase to cut the ends (Cout et al., 2007). A 35S:Arath-DGAT1 genetic construct encoding the A. thaliana DGATI diacylglycerol acyltransferase (. Bouvier-Nave et al, 2000) was prepared. Example 3 of WO 2009/129582 describes the AtDGAT1 construct in pXZP163. An amplified PCR fragment with KpnI and EcoORV ends was prepared from pXZP163 and inserted into pENTR11 to generate pXZP513E. The entire AtDGAT1 coding region of pXZP513E contained within a BamHI-EcoRV fragment was inserted into 35S-pORE04 at the Bam.41-ECORV site, generating pjP2078. A synthetic fragment, Arath-WRI1, coding for the transcription factor WRII from A. thaliana (Cernac and Benning, 2004), flanked by ECORI restriction sites and codon optimized for B. napus, was synthesized. A genetic construct designated 35S:Arath-WRI1 was prepared by cloning the entire coding region of Arath-WRI1, flanked by EcoRI sites in 35S-pORE04 at the Ecori site generating pjP3414. Expression of the genes in N. benthamiana leaf tissue was performed according to the transient expression system as described in Example 1.
[667] [667] Quantification of TAG levels of N. benthamiana infiltrated leaves by Iatroscan revealed that the combined expression of the A. thaliana DGATI and WRII genes resulted in 4.5 times and 14.3 times higher TAG content compared to WRII expression and the V2 negative control respectively (Table 9). This corresponds to an average and maximum observed yield of TAG per sheet dry weight of 5.7% and 6.51%, respectively (Table 9 and Figure 12). The increase in leaf oil was not solely due to overexpressed DGATI acyltransferase activity as was evident in the reduced TAG levels when WRII was left out of the blend. Furthermore, a synergistic effect was observed considering 48% of the total increase in TAG.
[668] [668] Both the DGATI and WRII constructs also led to an increase in oleic acid levels at the expense of linoleic acid in TAG fractions from infiltrated N. benthamiana leaves (Table 10). These results confirm recent findings by Andrianov et al. (2010) who reported syrnillary changes in the TAG, phospholipids and lipid fractions of TFA from transgenic tobacco plants transformed with the DGATI acyltransferase from A. thaliana. However, when the DGATI and WRII genes were co-expressed, a synergistic effect was observed on oleic acid accumulation in N. benthamiana leaves - this synergism accounted for an estimated 52% of the total oleic acid content, when. o both genes were expressed. Unexpected synergistic effects on both TAG accumulation and oleic acid levels in transgenic N. benthamiana leaves demonstrated the potential of simultaneously upregulating fatty acid biosynthesis and acyl uptake into nonpolar lipid as TAG in vegetative tissues, two metabolic processes that are highly active in oilseed development.
[669] [669] The transient expression experiment was repeatable, except that the viral silencing suppressor p1g was substituted for the V2 suppressor, and with careful comparison of samples on the same sheet to avoid any sheet-to-sheet variation. For this, a chimeric 35S:P19 construct for the expression of the tomato atrophy virus P19 viral silencing suppressor protein (Wood et al, 2009) was presented separately in A. tumefaciens GV3101 for co-infiltration.
[670] [670]Quantification of TAG levels of infiltrated N. benthamiana leaves by Iatroscan in this experiment reveals that the combined transient expression of the DGATI and WRI1i genes of A. thaliana resulted in a 141-fold increased TAG content compared to the negative control P19 (Fic 'ura 13). l When compared with the expression of the DGATI and WRII genes separately on the same leaf, the combined infiltration increased the levels of
[671] [671] Table 11 shows the fatty acid composition of TAG.
[672] [672] The observed synergistic effect of DGATI and WRI1 expression on TAG biosynthesis has been confirmed in more detail by comparing the effect of introducing into N. benthamiana both genes individually or in combination, and comparing with the introduction of a gene of Pí9 by itself, as a control, inside the same sheet. This was beneficial in reducing sheet-to-sheet variation. In addition, the number of replicates was increased to 5 and samples were collected across different leaves from the same plant to improve data quality. The results are shown in the Table
[673] [673] Based on the individual effects of both the WRII and DGATI genes upon expression in N. benthamiana and, in the presence of a mere additive effect but the absence of any synergistic effect, the present inventors expected a level of about 0, 35 TAG or a 35-fold increase over the P19 negative control. However, the introduction of both genes resulted in TAG levels that were 129 times higher than the P19 control. Based on these results, the present inventors estimated the additive effect and the synergistic effect on TAG accumulation as 26.9% and 73.1%, respectively. Furthermore, when the fatty acid composition of the total lipid in the leaf samples was analyzed by GC, a synergistic effect was observed at levels of C18:j^9 in the TAG fraction of infiltrated leaves of N. benthamiana with WRII. and DGATI (3 repetitions each). Data are shown in Table 11.
[674] [674] For seed-specific expression of the WRII + DGATI combination, Arabidopsis thaliana was transformed with a binary vector construct including a chimeric DNA having both pFAEI::WRII and pCln2::DGAT1 genes, or, for comparison, the genes individual pFAEI::WRII or pCln2::DGAT1. T1 seeds were harvested from plants. The oil content of the seeds is determined. Seeds have a higher oil content.
[675] [675] A chimeric DNA encoding Mus musculus MGAT2
[676] [676] When mouse MGAT2 and A. thaliana WRII transcription vector were co-expressed, mean N. benthamiana leaf TAG levels increased 3.3-fold compared to WRII expression alone ( Table 13). Furthermore, the expression of the two genes resulted in a small (29%) synergistic effect on leaf TAG accumulation. The TAG level obtained with the MGAT2 gene in the presence of WRII was 3.78% as quantified by Iatroscan (Figure 12). Similar results obtained with animal MGAT2 and vegetable DGATI acyltransferases in combination with A. thaliana WRII suggest that a synergistic effect may be a general phenomenon when WRI and acyltransferases are over-expressed in non-oil accumulating vegetative plant tissues.
[677] [677] The experiment was repeated to introduce constructs to express V2+MGAT2 compared to V2+MGAT2+WRI1, so that the infiltrated leaf samples were pooled into three leaves from the same plant, for two plants each .
[678] [678] The genes encoding the A. thaliana DGATI diacylglycerol acyltransferase, the mouse monoacylglycerol acyltransferase MGAT2 and the A. thaliana WRII were expressed in different combinations in N. benthamiana leaf tissue according to the system of N. transient expression as described in Example 1. A detailed description of the different constructs can be found in Examples 11 and 12.
[679] [679] The combined expression of the DGATI, WRII and MGAT2 genes resulted in an almost 3-fold greater mean increase in TAG when compared to the expression of the latter two' (Table 15). The maximum observed TAG yield obtained was 7.28% as quantified by Iatroscan (Figure 12). Leaf TAG levels were not significantly affected when the mouse MGAT2 acyltransferase gene was left out of this combination. The results described in Example 16, however, clearly demonstrated the positive effect of mouse MGAT2 on neutral lipid biosynthesis in N. benthamiana leaves, when expressed in combination with WRII, DGATI and the oleosin protein from Sesamum indicum.
[680] [680]Additional data were obtained from a new experiment where leaf samples were grouped with leaves from the same plant, 6 replicates of each. Data are shown in Table 16. Table 16. TAG content of infiltrated leaf samples of N. benthamiana. TAG gene combination (% dry weight) Ratio V2+MGAT2+DGAT1 1.08 ± 0.1 2.06 V2+MGAT2+DGAT1+ 2.22 ± 0.31
[681] [681] A 35S:GPAT4 genetic construct was prepared by cloning the A. thaliana GPAT4 gene (Zheng et al, 2003) from total RNA isolated from developing siliques, followed by insertion of an ECORI fragment into pjP3343 resulting in pjP3344. Other constructs are described in Examples 11 and 12. Transient expression in N. benthamiana leaf tissue was performed as described in Example 1.
[682] [682] Transient expression of GPAT4 acyltransferase from A.
[683] [683]Additional data were obtained from a new experiment where leaf samples were grouped with leaves from the same plant, 6 replicates of each. Data are shown in Table 18. Table 18. TAG content of infiltrated leaf samples of N. benthamiana. TAG gene combination (% dry ratio) V2+MGAT2+DGAT1 1.54 ± 0.36 1.01 V2+MGAT2+DGAT1+GPAT4 1.56 ± 0.18 Example acyltransferase and atDr from WRII transcription and in AGPase-bs2RNA silencer construction in E1anta cells
[684] [684] A DNA fragment corresponding to nucleotides 595-1187 of the mRNA encoding the small AGPase subunit of Nicotiana tabacum {DQ399915) (Kwak et al., 2007) was synthesized. The 1118501 NtAGP 593 bp fragment was first cut with NcoI, treated with large DNA polymerase I fragment (Klenow) to generate blunt 5' ends, and finally digested with Xhol. Similarly, input vector pENTR11-NcoI was first digested with BamHI, treated with large DNA polymerase I fragment (Klenow) and cut with Xhol. 1118501 NtAGP insert ligation in pENTRII-NCOI or pENTR11.-NcoI-NtAGP entry clone. The LR recombination between the pENTR11-NCOI-NtAGP input clone and the vector. target pHELLSGATE12 generated pTV35, a binary vector containing the NtZiGPase RNA1 cassette under the control of the 35S promotor. Other constructs are described in Examples 11 and 12. Transient expression in N. benthamiana leaf tissue was performed as described in Example 1. "
[685] [685] Expression of the N. tabacum AGPase silencing construct together with the genes encoding MGAT2 and WRI resulted in a 1.7-fold increase in leaf TAG levels as quantified by Iatroscan (Table 19). In the absence of MGAT2 acyltransferase TAG levels dropped almost 3-fold.
[686] [686] Overexpression of WRII and MGAT in combination with AGPase silencing is particularly promising for increasing oil yields in starch-accumulating tissues. Examples include tubers such as potatoes, and the endosperm of cereals, potentially leading to cereals with higher oil content in the beans (Barthole et al., 2011). Although the AGPase genes from N. tabacum and N. benthamiana are likely to have significant sequence identity, it is likely that an AGPase-hpRNAi construct from N. benthamiana will further elevate TAG yields due to greater silencing efficiency. [68'7] Additional data were obtained from a new experiment where leaf samples were grouped with leaves from the same plant, 6 replicates of each. Data are shown in Table 19 and 20. Table 20. TAG content of infiltrated leaf samples of N. benthamiana. Gene combination |TAG (% weightj Ratio I dry) V2+MGAT2+DGAT1+WRI1+Oleosin 1.93 ± 0.18 1.14 V2+MGAT2+DGAT1+WRI1+Oleosin+AGPase- 2.19 ± 0.19 hpRNAi Example 16. Constitutive expression of a monoaci1ae.ero1 aci1transerase, diac1queeroi aeltransferase, and factor of, Er,a,n,sc,r,ition, WRII and an oleosin protein in eé1; of =1 tapirs
[688] [688] A pRShl binary vector containing the gene encoding S. indicum seed oleosin (SCOtt et al., 2010) under the control of the 35S promoter was provided by Dr. N. Roberts (AgResearch Limited, New Zealand). Other constructs are described in Examples 11 and 12. Transient expression in N. benthamiana leaf tissue was performed as described in Example 1.
[689] [689] When sesame oleosin protein was expressed together with the transcription factor WRI from A. thaliana and MGAT2 acyltransferase from M. musculus, TAG levels in N.
[690] [690] The experiment was repeated with the combination of genes to express and V2 and V2 + MGAT2 + DGATI + + WRII + Oleosin, tested on different N. benthamiana plants with combined samples through leaves from the same plant and with 12 replicated infiltrations for each. Data are shown in Table 23. Reolicate samples were also collected using leaves from the same plant, with 6 repetitions for each infiltration: Data are shown in Tables 24 and 25.
[691] [691] Although infiltration of N. benthamiana leaves resulted in increased leaf oil (TAG) levels, no significant increase in total lipid content was detected, suggesting a redistribution of fatty acids from different lipids grouped into TAG was taking place. In contrast, when the MGAT2 gene was co-expressed with DGATI, WRII and oleosin genes, total lipids increased 2.21-fold, demonstrating a net increase in leaf lipid synthesis. Example 17 . ExEssion,o,o,n,st,tu.tu.tive _ of _ a mo,n,o,a,c,i.1g1cero1 acyltransferase, diaci1g1cero1 acyltransferase WRII and a cons.tFµc, t,ode_sA1,encj.amento FAD2=RNAi in
[692] [692] An N. benthamiana FAD2 RNA1 cassette under the control of a 35S promoter was obtained by LR recombination into the target vector pHELLSGATEB to generate vector pFN033. Other constructs are described in Examples 11 and 12.
[693] [693] The "genes encoding mouse monoacylglycerol acyltransferase MGAT2, A. thaliana diacylglycerol acyltransferase· DGATI, A. thaliana WRII, and N. benthamiana hairpin RNA1 FAD2 Lj12-fatty acid desaturase construct (Wood et al.,). Manuscript in preparation) were expressed in combination in N. benthamiana leaf tissue using the transient expression system as described in Example 1.
[694] [694] Similar changes were observed in the fatty acid compositions of TAG, polar lipids, and TFA from N. benthamiana leaves infiltrated with WRII, MGAT2, DGATI, and o
[695] [695] When these experiments were repeated and the fatty acid compositions determined for TAG, polar lipids, and total lipids, the results (Table 29) were consistent with the first experiment.
[696] [696] The enzymatic activity of M. musculus MGATI and MGAT2 has been demonstrated in Nicotiana benthamiana. The 35S:Musmu-MGAT1 and 35S:Musmu-MGAT2 chimeric vectors were introduced into AGLI strain of A. tumefaciens through the standard electroporation procedure and grown in solid LB medium supplemented with kanamycin (50 mg/L) and rifampicin (25 mg/L) L) and incubated at 28°C for two days. A single colony was used to start the fresh culture. After 48 hours of culture with vigorous aeration, cells were harvested by centrifugation at 200x g and the supernatant removed. Cells were resuspended in a new solution containing 50% LB and 50% MS medium with a density of OD600 = 0.5. Leaf samples from aseptically in vitro cultivated Nicotiana benthamiana plants were taken and cut into square sections around 0.5-1 cm2 in size with a sharp scalpel while immersed in the A. tumefaciens solution. The wounded pieces of N. benthamiana' leaf submerged in A. tumefaciens were allowed to stand at room temperature for 10 min before being blotted dry on a sterile filter paper and transferred to unsupplemented MS plates. After a co-culture period of two days at 24°C, the explants were washed three times with sterile liquid MS medium, and finally dried with sterile filter paper and placed on selective solidified MS agar medium supplemented with 1, 0 mg/L benzylaminopurine (BAP), 0.25 mg/L indoleacetic acid (IAA), 50 mg/L kanamycin and 250 mg/L cefotaxime and incubated at 24°C for two weeks to allow bud development at from sheet disks of N.
[697] [697] The expression of the MGATI and MGAT2 transgenes was determined by Real-Time PCR. Highly expressing strains were selected and their seeds harvested. This seed was planted directly into the soil and the segregating seedling population harvested after four weeks. Highly expressing events were selected and the seeds produced by these planted directly into the soil to provoke a segregating population of 30 seedlings. After three weeks, leaf discs were removed from each seedling for DNA extraction and subsequent PCR to determine which strains were genetically modified and which were null for the transgene. The population was then harvested with all aerial tissue from each seedling clean of soil and lyophilized. The dry weight of each sample was recorded and total lipids isolated. The TAG in these total lipid samples was quantified by TLC-FID and the proportion of TAG to internal standard urri (DAGE) in each sample determined (Figure 14) The mean TAG level in transgenic seedlings of 35S:Musmu-MGAT2 lineage 3347-19 was 4.1 times higher than the mean TAG level in the null seedlings. .3 times greater than the mean of null events. Constitutive expression in A. thaliana
[698] [698] The enzymatic activity of M. musculus MGATI and MGAT2 has been demonstrated in A. thaliana. The 35S:Musmu-MGAT1 and 35S:Musmu-MGAT2 chimeric vectors together with the empty control vector pORE04 were transformed into A. thaliana by the floral dip method and seed of selected primary transformants in kanamycin medium. T2 seeds from these T1 plants were harvested and TFA from the seeds of each plant determined (Figure 15). The mean TFA in mg/g of seed proved to be 139 ±13 for the pORE04 control lines with a mean of 136.0, 152 ±14 for the 35S:MGAT1 lines with a mean of 155.1 and 155 ±11 for the 35S lines: MGAT2 with an average of 154.7. This represented an average increase in TFA compared to the controls of 9.7% for 35S:MGAT1 and 12.1% for 35S:MGAT2. Example 19. Additional Genes Further increases in oil
[699] [699]Additional genes are tested in parallel with the combinations described above to determine if additional oil increases can be achieved. These include the following Arabidopsis genes: AT4G02280, sucrose synthase SUS3; AT2G36190, Invertase CWINV4; AT3G13790, CWINVI Invertase; AT1G61800, glucose 6 phosphate: phosphate translocator GPT2; AT5G33320, PPT1 phosphoenolpyruvate transporter; AT4G15530, Pyruvate orthophosphate dikinase plastid-PPDK; AT5G52920, Pyruvate kinase ppK-j31. The genes encoding these enzymes are synthesized and cloned into a binary constitutive expression vector pjP3343 as EcoRI fragments for testing in N. benthamiana. ,
[700] [700]When a number of genes that were added to the combination of WRII, DGATI, MGAT2 and oleosin and expressed in N. benthamiana leaves, an additional increase in the TAG level was observed, namely for: safflower PDAT, Arabidopsis thaliana PDATI, Arabidopsis thaliana DGAT2, Arabidopsis thaliana caleosin, peanut oleosin, Arabidopsis thaliana hemoglobin 2, iPLAh Homo sapiens, Arabidopsis thaliana GPAT4, E. coli G3P dehydrogenase, Arabidopsis thaliana dehydrogenase G3P, LPAAT2 from fruticin betas, NM-Frulidose beta-AT1 112232), Arabidopsis thaliana beta-fructofuranosidase (cwINV4, NM 129177), indicating that none of the enzymatic activities were rate-limiting in N. benthamiana leaves when transiently expressed. This does not indicate that they will have no effect on stably transformed plants, such as seed or other organisms.
[701] [701]Other additional genes are tested for synergistic o'j additive activity in oil enhancement. These include the following gene models of Arabidopsis thaliana or its encoded proteins, and homologues from other species, which are grouped by putative function and have previously been shown to be up-regulated in tissues with increased oil content. Genes/proteins involved in sucrose degradation: AT1G73370, AT3G43190, AT4G02280, AT5G20830, AT5G37180, AT5G49190, AT2G36190, AT3G13784, AT3G13790, AT3G52600. Genes/Proteins Involved in the Pentose Phosphate Oxidative Pathway: AT3G27300, AT5G40760, AT1G09420, AT1G24280, AT5G13110, AT5G35790, AT3G02360, AT5G41670, AT1G64190, AT2G45290, AT3G60750, AT1G1824103, ATG24103 , AT1G71100, AT2GO1290, AT3G04790, AT5G44520, AT4G26270, AT4G29220, AT4G32840, AT5G47810, AT5G56630, AT2G22480, AT5G61580, AT1G18270, AT2G36460, AT3G544011,702 ATG5570, ATG5555 Genes/proteins involved in glycolysis: AT1G13440, AT3G04120, AT1G16300, AT1G79530, AT1G79550, AT3G45090, AT5G60760, AT1G56190, AT3G12780, AT5G61450, AT1G09780, AT3G08590, AT3G2170G, AT3G45090, AT5G60760, AT1G56190, AT3G12780, AT5G61450, AT1G09780, AT3G08590, AT3G2701G Genes/proteins that function as plastid transporters: AT1G61800, AT5G16150, AT5G33320, AT5G46110, AT4G15530, AT2G36580, AT3G52990, AT3G55650, AT3G55810, AT4G26390, AT5G08570, AT5G562952960, ATG3163060, AT53 Genes/proteins involved in malate and pyruvate metabolism: AT1G04410, AT5G43330, AT5G56720, AT1G53240, AT3G15020, AT2G22780, AT5G09660, AT3G47520, AT5G58330, AT2G19900, AT5G11670, AT5G0547020, AT2G22780, AT5G09660, AT3G47520, AT5G58330, AT2G19900, AT5G11670, AT5G0587080.
[702] [702] Constructs are prepared that include sequences encoding these candidate proteins, which are infiltrated into N. benthamiana leaves as in previous experiments, and the fatty acid content and composition analyzed. Genes that help to increase the nonpolar lipid content are combined with the other genes, as described above, mainly those encoding MGAT, Wril, DGATI and an oleosin, and used to transform plant cells. Increases in unusual fatty acids
[703] [703] Additional genes are tested in parallel with the combinations described above to determine if unusual fatty acid increases can be achieved. These include the following genes (GenBank Nos. accession number is provided) which are grouped by putative function and homologs from other species. Delta-12 acetylenases ABCO0769, CAA76158, AAO38036, AAO38032; Delta-12 conjugases AAG42259, AAG42260, AAN87574; Delta-12 desaturases P46313, ABS18716, AAS57577, AAL61825, AAF04093, AAF04094; Delta-12 epoxygenases XP 001840127, CAA76156, AAR23815; Delta-12 hydroxylases ACF37070, AAC32755, ABQO1458, AAC49010: and Delta-12 P450 enzymes such as AF406732.
[704] [704] Constructs are prepared that include sequences encoding these candidate proteins, which are infiltrated into N. benthamiana leaves as in previous experiments, and the fatty acid content and composition analyzed. The nucleotide sequences of the coding regions can be codon-optimized for the host species of interest. Genes that help to increase unusual fatty acid content are combined with the other genes, as described above, mainly those encoding MGAT, WRII, DGATI and an oleosin, and used to transform plant cells. Example 20. Stable transformation of tapas including Nicotiana tabacum with oil-boosting combinations
[705] [705] An existing binary expression vector, pORE04+11ABGBEC (US Provisional Patent Application 61/660392), which contained a double enhanced region 35S promoter expressing the kanamycin resistance gene NPTII and three gene expression cassettes , was used as a starting vector to prepare several constructs each containing a combination of genes for the stable transformation of plants.
[706] [706] The binary vectors pjP3502 and pjP3503 were introduced separately into the A. tumefaciens AGLI strain by a
[707] [707] Leaf samples of N. tabacum cultivar W38 cultured aseptically in vitro were excised with an urri scalpel and cut into pieces of about 0.5-1 cm2 while immersed in suspensions of A. tumefaciens. The cut leaf pieces were left in suspensions of A. tumefaciens at room temperature for 15 minutes, before being blotted dry on a sterile filter paper and transferred to MS plates, without antibiotic supplement. After a co-culture period of two days at 24°C, the explants were washed three times with sterile liquid MS medium, and finally dried with sterile filter paper and placed on selective solidified MS agar medium supplemented with 1 0.0 mg/L benzylaminopurine (BAP), 0.5 mg/L indoleacetic acid (IAA), 100 mg/L kanamycin and 200 mg/L cefotaxime. The plates were incubated at 24°C for two weeks to allow the development of shoots from the mutated pieces of N. tabacum.
[708] [708] To establish in vitro rooted transgenic plants, healthy green shoots were cut and transferred to MS agar medium supplemented with 25 µo/L of IAA and 100 rng/L of kanamycin and 200 mg/L of cefotaxime. After roots had developed, the individual plants were transferred to the soil and grown in the greenhouse. Leaf samples were collected at different stages of plant development, including,
[709] [709] For transformation with pjP3503 ("4-gene construct"), leaf samples of about 1 cm2 were taken from 30 primary transformants before flower buds forming and TAG levels in the samples were quantified by Iatroscan. Seven plants were selected for further analysis, five of which had increased leaf oil levels and two had essentially the same oil levels as wild-type plants. Lyophilized leaf samples from these plants were analyzed for total lipid content and TAG content and fatty acid composition by TLC and GC. Transformed plants numbered 4 and 29 were shown to have considerably increased leaf oil levels compared to wild type, whereas plant number 21 had the lowest TAG levels essentially at wild type levels (Table 30). Plants numbered 11, 15 and 27 had intermediate leaf oil levels. Oleic acid levels in TAG were shown to be inversely correlated with TAG yields, consistent with the results of previous transient expression experiments in N. benthamiana.
[710] [710] In the transformed plants numbered 4 and 29, leaf oil content (as a percentage of dry weight) was shown to considerably increase flowering time (Table 31). From the data in Table 31, the increase was at least 1.7 and 2.4 times for plants 4 and 29, respectively. No change was observed for plant 21 which had TAG levels similar to wild-type control. Oleic acid levels in the isolated TAG fractions from each sample followed a similar pattern. This fatty acid accumulated up to 22.1% of the fatty acid in the TAG of plants 4 and 29, a 17-18-fold increase compared to plant 21 and wild-type. The increase in oleic acid was accompanied by an increase in linoleic acid and palmitic acid levels, while linolenic acid levels decreased 8-fold compared to plant 21 and the wild-type control. Unlike TAG, polar lipid levels decreased slightly at the flowering stage in the three strains (Table 32). Changes in monounsaturated and polyunsaturated C18 fatty acid levels in polar lipid fractions of the three strains were similar to changes in their composition in TAG although changes in oleic acid and linoleic acid were less pronounced. Significant increases in total leaf libid of lines 4 and 29 were observed during flowering, with levels reaching more than 10% of dry weight (Table 33). Total lipid levels in plant leaf 21, before and during flowering were similar to levels observed in wild-type plants at similar stages (Tables 33 and 35). Changes in the fatty acid composition of total lipids of all three plants were similar to the respective TA,G fatty acid compositions. Leaf oil in plant 4 during seed adjustment .has been shown to be higher at the onset of leaf chlorosis. The highest leaf TAG levels detected at this stage corresponded to a 65-fold increase compared to similarly aged leaves in plant 21 during seed adjustment and a 130-fold increase. err'. comparison with similar leaves from wild-type flowering plants (Table 34; Figure 18).
[711] [711] The increase in TAG in this plant coincided with elevated levels of oleic acid. Unlike plant 4, leaf TAG levels in the other two primary and wild-type tobacco transformants did not increase, or only marginally increased, after flowering and during chlorosis. The lower leaves of plants 4 and 29 showed reduced levels of TAG on senescence. In all plants, linoleic acid levels dropped while α-linolenic acid levels increased with increasing leaf age.
[712] [712] In line with increasing TAG levels, total lipid levels in leaves of plants 4 and 29 during sern adjustment were higher compared to similar leaves of both plants during flowering (Tables 33 and 35) . The highest level of total lipids detected in plant 4 on a dry weight basis was 15.8%, equivalent to a 7.6 and 11.2 times greater increase compared to similar leaves from plants and 21 wild-type plants. , respectively. Although the fatty acid composition of total lipids in the leaves of wild-type plant and plant 21 were similar, significant differences were observed in plants 4 and 29. These changes mirrored those found in TAG of both primary transformants.
[713] [713] Interestingly, leaves of plants 4 and 29, before and during seed adjustment were characterized by a shiny surface, providing a phenotypic change that can serve as a phenotype that is easily assessed visually, which can contribute to timing harvest, for maximum oil content.
[714] [714] In summary, leaves from plants 4 and 29 rapidly accumulated TAG during flowering, until seed adjustment.
[715] [715] For transformation with pjP3502 ("3-gene construct"), the sucrose content in MS agar medium was reduced to half the normal level until sufficient calli were established, which aided the recovery of WRII expressing transformants. Forty-one primary transformants were obtained from transformation with pjP3502 and transferred to the greenhouse. Leaf samples of different ages were collected at each stage of flowering or seed adjustment (Table 36). Plants appear phenotypically normal except for three transformants, originating from the same callus in the transformation process and therefore likely to be from the same transformation event, which were somewhat smaller and showed a shiny leaf phenotype similar to that observed for plant 4 with pjP3503 (above), but less in extension.
[716] [716] Leaf disk samples of primary transformants were collected during flowering and TAG was quantified visualized by iodine staining after TLC. Selected transgenic plants exhibiting higher levels of TAG compared to wild-type controls were further analyzed in greater detail by TLC and GC. The highest TAG level in young green leaves was detected in lineage 8.1 and corresponded to 8.3% TAG on a dry weight basis or an approximate 83-fold increase compared to age-matched wild-type leaves (Table 36). Yellow-green leaves typically contained a higher oil content compared to younger green leaves with maximum TAG levels observed in lineages of 14.1 (17.3% TAG on a dry weight basis). Total lipid content and fatty acid composition of total lipid in the leaves were also quantified (Table 37).
[717] [717] Seed (seinent Tl) was collected from the primary transformants at seed maturity and some were planted to produce Tl plants. These plants were predicted to be secreting into the transgene and therefore
[718] [718]Genetic constructs suitable for the transformation of monocotyledonous plants are made by switching from Arath-SSU promoters in pjP3502 and pjp3503 to more active promoters' in monocotyledons. Suitable promoters include constitutive viral promoters from monocotyledonous viruses or promoters that have been shown to function in a transgenic context in monocotyledonous species (eg, the Ubi promoter from maize described by Christensen et al., 1996). Likewise, the CaMV-35S promoters in pjP3502 and pjP3503 are exchanged for promoters that are more active in monocot species. These constructs are transformed into wheat, barley and corn using conventional methods. Miscanthus Species
[719] [719]Genetic constructs for the transformation of Miscanthus species are made by switching the Arath-SSU promoters in pjP3502 and pjP3503 to the more active promoters in Miscanthus. Suitable promoters include constitutive viral promoters, a ubiquitin promoter (Christensen et al., 1996) or promoters that have been shown to function in a transgenic context in Miscanthus. Likewise, the CaMV-35S promoters in pjP3502 and pjP3503 are exchanged for promoters that are more active in Miscanthus. New constructs are transformed into Miscanthus by a microprojectile-mediated method similar to that described by Wang et al. 2011. Switchgrass (Panicum virgatum)
[720] [720]Genetic constructs for switchgrass transformation are made by exchanging the Arath-SSU promoters in pjP3502 and pjP3503 for the most active promoters in switchgrass. Suitable promoters include viral promoters, constitutive promoters or promoters that have been shown to function in a transgenic context in switchgrass (eg, Mann et al. 2011). Likewise, the CaMV-35S promoters in pjP3502 and pjP3503 are exchanged for promoters that are more active in switchgrass. New constructs are transformed into switchgrass by an Agrobacterium-mediated method similar to that described by Chen et al. 2010 and Ramamoorthy and Kumar, 2012. Sugarcane
[721] [721] Genetic constructs for sugarcane transformation are made by switching the Arath-SSlj promoters in pjP3502 and pjP3503 to the more active promoters in sugarcane. Suitable promoters include viral promoters, constitutive promoters or promoters that have been shown to function in a transgenic context in sugarcane (for example, the Ubi promoter from maize described by Christensen et al., 1996). Likewise, the CaMV-35S promoters in pjF3502 and pjP3503 are exchanged for promoters that are more active in sugarcane. New constructs are transformed into sugarcane by a microprojectile-mediated method similar to that described by Bower et al. 1996. Elephant grass
[722] [722] Genetic constructs for the transformation of Pennisetum purpureum are made by switching the Arath-SSU promoters in pjP3502 and pjP3503 to the more active promoters in elephant grass. Suitable promoters include viral promoters, constitutive promoters or promoters that have been shown to function in a transgenic context in Pennisetum species such as P. glaucum type (eg, the maize Ubi promoter described by Christensen et al., 1996). Likewise, the CaMV-35S promoters in pjP3502 and pjP3503 are exchanged for promoters that are more active in Pennisetum species. New constructs are transformed into P. purpureum by a microprojectile-mediated method similar to that described by Girgi et al. 2002. Lolium
[723] [723] Genetic constructs for Lolium perenne and transformation of other Lolium species are made by switching the Arath-SSU promoters in pjP3502 and pjP3503 to the more active promoters in ryegrass. Suitable promoters include viral promoters, constitutive promoters or promoters that have been shown to function in a transgenic context in Lolium species (for example, the corn Ubi promoter described by Christensen et al., 1996). Likewise, the CaMV-35S promoters in pjP3502 and pjP3503 are exchanged for promoters that are more active in Pennisetum species. New constructs are transformed into Lolium perenne by a silicon carbide-mediated method, similar to that described by Dalton et al. 2002 or an Agrobacterium-mediated method similar to that described by Bettany et al. 2003.
[724] [724]pjP3502 and pjP3503 are modified to seed-specific expression genetic constructs, exchanging the CaMV-35S and Arath-SSU promoters (except the selectable marker cassette) with seed-specific promoters active in the target species.
[725] [725]Genetic constructs for Brassica napus transformation are made by switching the CaMV-35S and Arath-SSU promoters in pjP3502 and pjP3503 to the more active promoters in canola. Suitable promoters include promoters that have previously been shown to function in the transgenic context in Brassica napus (e.g., the FAEI A. thaliana promoter, Brassica napus napin promoter, Linum usitatissimum conlininl and conlinin2 promoters). New constructs are transformed into B. napus as described above. soy (Glycine max)
[726] [726] A genetic construct is made by cloning the PspOMI fragment from a synthesized DNA fragment having the nucleotide sequence shown in SEQ ID NO:415 (soybean synergy insert; Figure 19A) into a binary vector such as porE04 at the Notl site . This fragment contains Arath-WRII expressed by an Arath-FAE1 promoter, Arath-DGAT1 expressed by a Linus-Cnl2 promoter, Musmu-MGAT2 expressed by Linus-CnII and Arath-GPAT4 expressed by Linus-CnII. Another genetic construct is made by exchanging the GPAT coding region for an oleosin coding region. Another genetic construct is made by MGAT expression cassette exclusion.
[727] [727] A genetic construct, pjP3569 (Figure 21), was generated by cloning the Sbfl-Pstl fragment from the DNA molecule having the nucleotide sequence shown in SEQ ID NO:415 at the Pstl site of pORE04. This construct contained (i) a coding region encoding the A. thaliana WRII transcription factor, codon-optimized for G. max expression, and expressed from G. max kunitz 3 trypsin inhibitor 3 promoter ( Glyma-KTi3), (ii) a coding region encoding the DGAT2A Umbelopsis ramanniana promoter (codon-optimized as described by Lardizabal et al., 2008) and expressed from the alpha-subunit beta-conglycinin promoter of G. max (Glyma-b-conglycinin) and (iii) a coding region encoding M. musculus MGAT2 codon-optimized for G. max expression. A second genetic construct, pjP3570, was generated by cloning the Sbfl-Swal fragment of the DNA molecule having the nucleotide sequence shown in SEQ ID NO:415 in pORE04 into the EcoRV-Pstl sites to produce a binary vector containing the genes they express Transcription Factor WRII from A. thaliana and enzyme DGAT2A from U. ramanniana. Similarly, a third genetic construct, pjP3571, was generated by cloning the AsiSl fragment of the DNA molecule having the nucleotide sequence shown in SEQ ID NO:415 to the AsiSl site of porE04 to produce a binary vector that contains a gene that codes for the enzyme DGAT2A U. ramanniana. A fourth genetic construct, pjP3572, was generated by cloning the NotI fragment of the DNA molecule having the nucleotide sequence shown in SEQ ID NO:415 in pORE04 at the NotI site to produce a binary vector that contains a gene that expresses the transcription factor WRII from A. thaliana. A fifth genetic construct, pjP3573, was generated by cloning the Swal fragment of the DNA molecule having the nucleotide sequence shown in SEQ ID NO:415 in pORE04 at the site
[728] [728] A sixth genetic construct, pjP3580, is generated by replacing M. musculus MGAT2 with the oleosin gene from Sesamum indicum.
[729] [729] Each of these six constructs is used to transform soybeans, using the methods as described in Example 6. Transgenic plants produced by transforming with each of the constructs, particularly pjP3569, produce seeds with higher oil content.
[730] [730] The vectors pjP3502 and pjp3503 (see above) as used for tobacco transformation are used to transform sugar beet (Beta vulgaris) plants by Agrobacterium-mediated transformation as described by Lindsey & Gallois (1990). Plants produce a large increase in TAG levels in their leaves, similar to the extent of tobacco plants produced as described above. Transgenic beet plants are harvested while the leaves are still green or preferably green/yellow shortly before the onset of senescence or earlier in this developmental process, that is, and while the sugar content of the beet is at a high level and after allow the accumulation of TAG on the leaves. This allows the production of dual purpose beets, which are suitable for the production of sugar beet and lipid from the leaves; the lipid can be converted directly to biodiesel by crushing the sheets and centrifuging the resulting material to separate the oil fraction, or directly producing hydrocarbons by pyrolyzing the sheet material.
[731] [731] Promoters that act on the root (tuber) of sugar beet are also used to express transgenes in the tuber. Example 21. Transfoão est,á,ve,í_de_ SQ1an,z=_t,ub,e=Qs" with
[732] [732]pjP3502, the binary intermediate expression vector described in the previous example, was modified by first removing an SSU promoter by ASCI + NCoI digestion and substituting with the potato B33 promoter flanked by AscI and NCOI to generate pjP3504. The SSU promoter in pjP3504 along with a fragment of the A. thaliana WRLI gene was replaced at the PspOMI sites by a potato B33 promoter with the same fragment of the A. thaliana WRLI gene flanked by NotI--PspOMI to generate pjP3506. pjP3347 was added to pjP3506 as described in the example above to generate pjP3507. This construct is shown schematically in Figure 20. Its sequence is shown in SEQ ID NO:413. The construct is used to transform the potato (Solanum tuberosum), to increase the oil content in tubers.
[733] [733] The enzymatic activity of GPAT-MGAT enzyme fusions is tested to determine whether this would enhance the accessibility of MAG produced by GPAT to MGAT activity. An appropriate linker region was first synthesized and cloned into a cloning vector. This linker contained sites suitable for cloning the N-terminal (EcoRI-Zral) and C-terminal coding regions (Ndel-Smal or Ndel or Pstl).
[734] [734] atttaaatgcggccgcgaattcgtcgattgaggacgtccctactagacctgctg gacctcctcctgctacttactacgattctctctcgctgtgcatatggtcagtcatgcccgggcctg caggcggccgcatttaaat (SEQ ID NO:41)
[735] [735] A GPAT4-MGAT2 fusion (GPAT4 N-terminal and MGAT2 C-terminal) was made by cloning a first DNA fragment encoding A. thaliana GPAT4, flanked by Mfel and Zral sites and lacking a codon of C-terminal termination, to the EcoRI-Zral sites. The DNA fragment encoding MGAT2 M.
[736] [736] Similarly, an MGAT2-GPAT4 fusion (MGAT2 N-terminal and GPAT4 C-terminal) was first made by cloning the DNA fragment encoding MGAT2 M. musculus, flanked by Ecori and Zral sites without a stop codon C-terminal, at the EcoRI-Zral sites. The DNA fragment encoding the GPAT4 A. thaliana, flanked by NdeI-Pstl sites, was then cloned into the NdeI-Pstl sites to generate a single MGAT2-GPAT4 coding sequence. The fused coding sequence was then cloned as a NotI fragment into pYES2 to generate pYES2::MGAT2-GPAT4 and the binary constitutive expression vectors pjP3343 to generate pjP3343::MGAT2-GPAT4.
[737] [737] Yeast expression vectors are tested in yeast S. cerevisiae, and binary vectors are tested in N. benthamiana for oil content and composition with single-coding region controls. Example 23. Discovery of new WRLI 3e=ences
[738] [738] Three new WRLI sequences are cloned into pjP3343 and other suitable binary constitutive expression vectors and tested in N. benthamiana. These include the genes encoding Sorbi-WRLI1 (from Sorghum bicolor; SEQ ID NO:334), Lupar' -WRL1 (from Lupinus angustifolius; SEQ ID NO:335) and R1CCO-WRL1 (from Ricinus communis, SEQ ID NO:336). These constructs are tested against the Arabidopsis WRII encoding gene in the N. benthamiana leaf assay.
[739] [739] As an initial step in the process, a partial CDNA fragment corresponding to WRLI was identified in the EST database of developing seeds of Lupinus angustifolius (NA-080818 Plate14f06.b1, SEQ ID NO:277). Full-length IJm CDNA (SEQ ID NO:278) was subsequently recovered by performing 5' and 3'-RACE PCR using nested primers and CDNAS isolated from developing seeds.
[740] [740] James et al. (2010) reported that silencing the A. thaliana homologous CGI-58 resulted in up to 10-fold TAG accumulation in leaves, mainly in the form of lipid droplets in the cytosol. Galactolipid levels were also shown to be higher, while the levels of most major phospholipid species remained unchanged. Interestingly, TAG levels in seeds were not affected and, unlike other TAG degradation mutants, no negative effect on seed germination was observed.
[741] [741] Three full-length and two partial transcripts have been found in an N. benthamiana transcriptome showing homology to the A. thaliana CGI-58 gene. A 434 bp region present in all five transcripts was amplified from leaf RNA isolated from N. benthamiana and cloned via LR (gateway) cloning into the target vector pHELLSGATE12. The resulting expression vector designated pTV46 encodes a hairpin RNA (dsRNA) molecule to reduce the expression of the tobacco gene encoding the CG1-58 homolog and was used to transform N. tabacum, as described in Example 1, generating 52 transformants primary.
[742] [742]Primary transformants that show higher levels of TAG in their vegetative tissues are crossed with homozygous strains described in Example 20. Example 25. =eaena subunit silencing ADP icosis erophosphoryl,a,s,e (,AG,P,a ,s,e.) _ of _ N]ab,a,c,um
[743] [743] Sanjaya et al. (2011) showed that silencing the small AGPase subunit in combination with WRI overexpression further increased TAG accumulation in A. thaliana seedlings, while ainide levels were reduced. A small AGPase subunit has been cloned from flower buds (Kwak et al., 2007). The deduced amino acid sequence revealed 87% identity with the A. thaliana AGPase. A 593 bp fragment was synthesized and cloned into pHELLSGATE12 through LR cloning (gateway), resulting in the binary vector pTV35. Transformation of N. tabacum was done as described in Example 1 and generated 43 primary transformants.
[744] [744] Primary transformants indicating a reduction in total leaf starch levels are crossed to homozygous lines described in Examples 20 and 21. In addition, primary transformants are crossed to homozygous lines that are the result of a passage of the lines described in 20 and 21. ExeInE1o 26. Production and use of constructions of combinations of ,Aenes ínàmíndo a ,Romotor inducíye,1,
[745] [745] Other genetic constructs are made using an inducible promoter system to drive the expression of at least one of the genes in the gene combinations, as described above, particularly in pjP3503 and pjP3502. In the modified constructs, the WRII gene is expressed by an inducible proinotor such as the Aspergillus niger alcA promoter, in the presence of an expressed Aspergillus niger alcR gene. Alternatively, a DGAT is expressed using an inducible promoter. This is advantageous when maximum TAG accumulation is not desirable at all times.
[746] [746]TAG can be increased by co-expression of transcription factors, including embryogenic transcription factors such as LEC2 or BAÉY BOOM (BBM, Srinivasan et al., 2007). These are expressed under the control of inducible promoters described above and are transformed & into transgenic lines or co-transformed with WRI and DGAT.
[747] [747]pjI3590 is generated by cloning a MAR spacer as an AatII fragment into the AatII site of pORE04. pjP3591 is generated by cloning a second MAR spacer as a KpnI fragment into the KpnI site of pjP3590. pjP3592 is generated by cloning the SmaI-AsiSl fragment of the DNA molecule having the nucleotide sequence shown in SEQ ID NO:416 (12ABFJYC pjP3569 insert; Figure 19B) into the As1SI-EcoRV sites of pjP3591. pjP3596 is aerated by cloning a Pst1-flanked inducible expression cassette containing the alcA promoter expressing the M. musculus MGAT2 and a Glycine max lectin polyadenylation signal to an Sbfl site introduced into pjP3592. Hygromycin resistant versions of both pj23592 and pjP3596 (pjP3598 and pjP35o7, respectively) are generated by replacing the selectable marker gene NPTII with the HPH gene flanked at the FseI-AscI sites.
[748] [748] These constructs are used to transform the same plant species as described in Example 20. Expression from the inducible promoter is increased by treatment with the inducer of the transgenic plants after they have grown substantially so that they accumulate a increase in TAG levels. These constructs are also super-transformed into stably transformed constructs already containing an augmented oil construct, including the TDNA region of three genes or four genes (SEQ ID NO:411 and SEQ ID NO:412, respectively). Alternatively, gene expression cassettes from the three-gene and four-gene constructs were cloned into the NotI sites of pjP3597 and pjP3598 to obtain a combined constitutive and inducible vector system for high fatty acid and TAG synthesis, accumulation and the storage.
[749] [749] In addition to other inducible promoters, an alternative is that gene expression can be thermo-orally and spatially restricted using promoters that are only active during specific periods of development or in specific tissues. Chemically inducible endogenous proinotors are also used to limit expression to specific windows of development.
[750] [750] It will be appreciated by persons skilled in the art that numerous variations and/or modifications can be made to the invention as shown in the specific embodiments without departing from the spirit and spirit of the invention so broadly described. The present modalities must, therefore, be considered in all respects as illustrative and not restrictive.
[751] [751] The present application claims priority from US 61/580590 filed December 27, 2011 and US 61/718,563 filed October 25, 2012, the entire contents of both of which are incorporated herein" by reference.
[752] [752] All publications discussed and/or referenced in this document are hereby incorporated in their entirety.
[753] [753] Any discussion of documents, acts, materials, devices, articles or the like that has been included in this specification is solely for the purpose of providing a context for the present invention. It should not be taken as an admission that any or all of these matters form part of the prior art background or common knowledge in the field relevant to the present invention as it existed prior to the priority date of each claim of this application.
:,;i$S.Á -r :' . . 370/375
REFERENCES Abdullah et al. (1986) Biotech. 4:1087. Al-Mariri et al. (2002) Infect. Immun. 70:1915-1923. Alemanni et al. (2008) Plant 227:853--866. Almeida and Allshire (2005) TRENDS Cell Biol. !5:251-258. Alonso et al. (2010) Green Chqn. 12:1493-1513. Alvarez et al. (2000) Theor. Appl. Genet." 100:319-327. Andrianov et al. (2010) Plant Biotech. J. 8:277-287. Barthole et al. (2011) Pknt Sci. 185-186:33-39. Bartlett et al. ( 2008) Plant Methods 4:22 Baud et al (2007) Plant J 50:825-838 Baumlein et al (1991) MoL Gen Genet 225:459-467 Baumlein et al (1992) Plant J. 2:233-239. Benghezal et al. (2007) J. Biol. Chem. 282:30845-30855. Bettany et al. (2003) Plant Cell Rep. 21:437A44. Bligh and Dyer (1959) Canadian Journal of Biochemistry and Physiology 37:g11-917.
Bohner et al. (1999) Plant J. 19:87-95. ¥ Bourque (1995) Piant Sci. 105:125-149. Boutilier et al. (2002) PIant Cell 14:1737-1749. Bouvier-Nave et al. (2000) European Journal of Biochemistry / FEBS 267:8.5-96. Bower et al. (1996) MOI. Breed. 2: 239-249. Bradford (1976) Anal. Biochem. 72:248-254. Brookhaerts et al. (2005) Nature 433:629-633. Broun et al. (1998) Plant J. 13:201-210. Bruce et al. (2000) P. Plant Cell 12:65-80. Buchanan-Wol]aston (1994) Plant Physiol. 105:839-846. Busk et al. (1997) Piant J. 11:285-1295. Cadwell and Joyce (1992) PCR Methods Appi. 2:28-33... Cao et al. (2003) J. Bioí. Chem. 278:13860-13866. Cao et al. (2007) j. Lipid Res. 48:583-591. Capuano et al. (2007) Biotechnol. .Av. 25:203-206. Cemac and Benn'ng. (2004) Plant J. 40:575-585 Chen et al. (2010) Biotechnol. for Biophiles. 3:9. Cheng et al. (1996) Pant Cell Rep. 15:653-657. , Cheng et al. (2003j J. Biol. Chem. 278, 13.6!-13614. 0 Chikwamba et al. (2CC3) Proc. Natl. Acad. Sci. JSA 100:III27-11132. Christensen and Quail (1996) Transgenic Res. '5:2t3-218.
Christie (1993) Advances in Lipid Methodology - Twd, Oily Press, Dundee, pages 195-213. " Chung et al. (2006) BMC Genomics 7:120. Clough and Bent (1998)'Plant J. 16:735-743. Coco et al. (2001) Nature Biotechnology 19:354-359. Coco et al. (2002) Nature.Biotechnology 20:1246-1250. Comai et al. (2004) Plant J 37:778-786. Corrado and Karali (2009) Biotechnol. Adv. 27:733-743. Courvalin et al.( 1995) Lice Sci. 318:1207-1212. Coutu et al. (2007) Transgenic Res.
Crameri et al. (1998) Nature 391:288-291. Dalton et al. (1998) Plant Science 132:31-43. Dandik and Aksoy (1998) Fuel Process Technol. 57: 8t92. Dagi et al. (1997) Cell 91:765-775. Dauk et a! (2007) Plant Sci. 173:43-49.. Deshpande (1992) Appl. Biochem. Biotechnol. 36:227-234. Dhadialla et al. (1998) Annu. Rev. Entomol, 43:545-569. Dietrich et al. (1998) Nature Biotech. 18:181-185. Dulemo and Nicaud (2011) Metab. Eng. 13:482-491., /b Dumett et al. (2008) Plant J. 54:593-607. Dyer et al. (2002) Plant Physiol. 130:2027-2038. Eggert et al. (2005) Chembiochem 6:1062-1067. . Ellerstrom et al. (1996) Piant Mol. Biol. 32:1019-1027. Endalew et al. (201 I) Biomass and Bioenergy 35:3787-3809. . Felenbok (1991) J. Biotechnol. 17:11-17. · Fennelly et al. (1999) J. Immunol. 162:1603-1610. Froissand et al. (2009) FEMS Yeast Res 9:428-438. F'jjimura et al. (1985) Plant Tissue Culture Lett. 2:74, , Gan (1995) Molecular characterization md genetic manipulation of plant senesce. PhD thesis. University of Wisconsin, Madison. Gan and Amasino (1995) Science 270:1986-1988, Gatz (1997] Annu. Rev. Plant Physiol. Plant Mol. Biol. 48:89-108. Ghosal et al.(2Q07) Biochimà et Biophysica Acta 1771:1457 -1463. Ghosh et al (20119) Plant Physiol 151:869-881 B Girgi et al (200') Molecular Breeding 10:243-252. Glevin et al (20b3) Microbiol. Mol. Biol. 67:16-37. Go&an et al.(1005) Plant Physiol. 138:2269-2279, Gong and Jiang (2011) Biotechnol. Letter 33:1269-1284.
)
K Gould et al. (1991) Plant Physiol. 95:426-434. Grant et al. (1995) Plant Cell Rep. 15:254-258. Greenwell et al. (2010) J.R. Soc. Interface 7:703-726. Gnllot-Courvalin et al. (1999) Curr. Opinion Biotech. 10(5):477-481. Grillot-Courvajin et al. (1998) Nature Biotech. 16:862-866, Gurel et al. (2009) Plant Cell Rep. 28:429-444. Harayama (1998) Trends Biotechnol. 16: 76-82. Haseloffand Gerlach (1988) Nature 334:585-591. Hellinga (1997) Proc. Natl. Acad.'Sc. 94:10015-10017. .
HenikoWet al. (2004) PIant Physiol 135: 630-636. Hense et al. (2001) Cell Microbiol. 3:599-609. Hershey and Stoner (1991) Plant Mol. Biol. 17:679-690. Hinchee et al. (1988) Biotechnology 6:915-922. . Hirayama and Hujii (1965) Agricultural and Biological Chemistry 29:1-6. ' Horvafh et al. (2000) Proc. Natl. Academic Sci. U.S.A. 97:1914-1919. Huang (1996) Plant Physiol. 110:1Cl55-1061. Iwabuchi et al. (2003) J. Biol. Chem. 278:4603-4610. Izawati et al. (2009) J. Oil Palm Res. 21:643-652. James et al. (2010) Proc. Natl. Academic Sci. USA 107: 7833-17838. Jackson et al. (1994) Plant Mol. Biol. 26:1855-1866. jézéquel et al. (2008) Biotechniques 45:523-532. Joviet et al. (2004) PJant Physiol. Biochem. 42:501-509. Karmakar et al. (2010) Bioresource Technology 101:7201-7210. Kindle (1990) Proc. Nat. Sci. USA 87: 1228-1232. Klein et al. (1998) Exp. Neurol. 150:183-194. Knothe (2905) Fuel Process. Technol. 86:1059-1070. Knothe and Steidley (2005.) Fuel 84:1059-1065. ' Koziel et al. (1996) PIant MOL Biol. 32:393-405. Kuhn et al. (2009) J. Biol. Chem. 284:34092-102. Kunik et al.'(2001) Proc. Natl. Academic Sci. U.S.A. 98:1871-1876. Kwak et al. (2007) Plant Physiol.' 145:277-289. Lacroix et d. (2008) Proc. Natl. Academic Sc1.U.S.A. 105: 15429-15434. Lakshminarayana et al. (1984) JAOCS 61:1249-1253. Lam et al. (2010) Biotechnol. Adv. 28:500-18. Lardizabal et al. (2001) J. Biol. ChÍ:m. 276:38862-38869. Lardizabd et al. (2008) Plant Physiol. 148: 89-96. Larkin et al. (1996) Transgenic Res. 5:325-335. N Lee et al. (1998) Science 280:915-918.
Leunget al. (1989) Technician 1:11-15.
Li et al.(1996) FEBS Lett 379:117-121. . Li et al. (2006) Phytochemistry 67: 904-915. Li et al. (2007) Proc. Natl. Academic Sci. US A. 104:18339-44. ' Lin et al. (2005) Plant Physiol. Biochem. 43:770-776. Lindsey and Gdlois (1990) Joumal of Experimental Botany 41:529-536. " Liu et al. (2010a) Fuel 89:2735-2740. Liu et al. (201Ob) Plant Physiol. Biochem. 48: 9-15. Lui et al. (2009) J. Agric. Food Chem. 57: 2308-2313. Maher and Bressler (2007) Bioresource Technology 98:2351-2368. Mann et al. (2011) BMC Biotechnol. 11:74. Martinez and Jq)son,.EcdySteroid agonist-inducible control of gene e cpression in plants In Inducible Gene Expression in Plants Edited by Reynolds PHS New York: CABI Publishing; 1999:23-41 Martinez et al (1999) Plant J. 19:97-106. Mátsuoka et al. J. 6:3)1-319. Meicr et al (1997) FEBS Lett, 415:91-95 Mett et al. (1993) Proc.Natl.Acad.Sci.USA 90:4567-4571. Millar and Waterhouse (2005), Funct Integr Genomics 5:129-135, Murashige and Skoog (1962) Plantarum Physiology 15:473-497, Needleman and Wunsch (1970) J. Mol Biol. 45: 443-453 Ness et al. (2002) Nature Biotechnology 20:1251-1255. Niedz et al.(1995) Plant Cell Reports 14:403-406. Ostermeier et al.(1999) Nature Biotechnology 17:1205-1209. Ow et al.(1986) Science 234:856-859. . Padidam (2003j Cijit. Qpin. Plant Biol. 6:169-77.
Padidam et al. (2003) Transgenic Res. 12:101-9, Panekina (1978) Chemistry of Natural Compounds 14:33-36. Parthibane et al. (2012) J. Biol. Chem. 287:1946-54. Pasquinelli et al. (2005). Curr opm Genet Develop 15:200-205. , Perez-Vich et al. (1998) JAOCS 75:547-555 Perriman et al. (1992) Gene 113:157-163, r Perrin et al. (2000) Mol Breed 6:345-352. Perry and Harwood (1993) Phytochemistry 33:329-333. Phillips et al. (2002) Journal of Food Composition and Analysis 12:123-142. Picard (1994) Cur. Top. Biotech. 5:511-515.
Pigeaire et al. (1997) Mol. Breed. 3:341-349. Potenza et al. (2004) In Vitro Cell Dev. Bio!. Plant 40:1-22. ,
Pogye11 et al. (1996) Vaccines 183, Abstract. Prasher et al. (1985) Biochem. Biophys. Common Res. 127:31-36.
U Qiu et al. (2001) j. Biol. Chem. 276:31561-3156 Ramamoorthy and Kumar (2012) PIant Cell Rep. 31:1923-1931. Riddiford et al. (2000) Vitam. Horm. 60:1-73. , Rossell and Pritchard (1991) Ana/ysis afOilseeds, Fats and Fatjy Foods. Elsevier Ruuska et al. (2002) Plant Cdl 14:1191-1206.
Ryan et al. (1984) J. Am. Oil Chem. Soc. 61:1610-1619. Saha, et al. (2006) Plant Physiol, 141:1533-1543. Sanjaya et al. (2011) Piant Biotech. J. 9:874-883. Schamer (1980) Proc. Natl. Acad'.'Sc. U.S.A. 77:2163-2167. Science Publishers Ltd: London (Chapter 2, pp.48-53). . Scott et al. (2010) Plant Biotechnol. J. 8(8):912-27 Semwal' et al. (201i) Bioresource TechnoloiW 102:2151-216i.
Senior (1998) Biotech. Genet. Engineering Revs: 151:79-119.
Shiau et al. (2001) Vaccine 19:3947-3956. ) Shiina et al. (1997) Plant Physiol. 115:477-[83. .
Shimada and Hara-Nishimura (2010) Biol, Phann. Bull. 33:360-363. Shippy et al., (1999) Mol. Biotech. 12:117-29. Sieber et d. (2001) Nature Biotechnology 13:456-460. Siioto et al. (2009) Lipids 44:963-973. Sizemore et al. (1995) Science 270:299-302; Slade and Knauf (2005) Transgenic Res. 14) 109-115.
Smith et al. (2000) Nature 407:319-320. Srinivasan et al. (2007) Blueprint 225:341-51. Staiker et al. 1988 Science 242: 419-423. Stemmer (1994a) Proc. Natl. Academic Sci. USA 91:10747-1075l. i' Stemmer (1994b) Nature 370(6488):389-3g1. Stobart et al. (1997) Blueprint 203:58-66. Tan et al (2011) Plant Physiol. 156:1577-1588. Taylor (1997) The PIant Cell 9:1245-1249. Thillet et al. (1988) J. Bio). Chem 263:12500-12508. ' .. Tingay et al. (1997) Plant J. 11:1369-1376. ' Toriyama et a!. (1986) Theor. Appl. Genet. 3:16-19. . Tumaney et al. (2001) J. Biol. Chem. 276:10847-10852. Tzfira and Citovsky (2006) Curr. Qpin. Biojech. 17:147-154. UGnasov et al. (1995) Plant Physiol. 108:91j-927. Unger et al. (2002) Transgenic Res. 11:455j465. * . , P van de Loo et al. (1995) Proc Natl Acad Sci U S A. 92:6743-6747. Voinnet et al. (2003) Plant J. 33:949-956. Volkov et al. (1999) Nucleic Acids Research 27(18):-e18. Wang et al. (2011) J.
Agricultural
Food CheIn. 60:144-52. Waterhouse et al (1998). Proc.
Natl.
Academic
Sci.
USA 95:13959-13964, . J. 5:559-569. VJeinmann et al. (1994) Plant Weiss (2003) Int. J.
Med.
Microbiol. 293:95-106. Wesdake et al. (2009) Biotechnology Advances 27:866-878. Winans et al. (1988) Journal of acteriology 170:4047-4054. Wood et al. (2009). Plant Biotech
J. 7: 914-924. Wood et al., mmuscript in preparation Yang et al. (2003) Blueprint 216:597-603. Yang" et a!. (2010) PNAS "107:12040-12045. . Yen and Farese (2003) J.
Biol.
Chem. 278:18532-18537. Yen et al. (2002) Proc.
Natl.
Academic
Sci.
U.S.A. 99:8512-8517. Yen et al. (20Q5) j.
Lipid Res. 46: 1502-151]. Zhang et al. (1999a) Plant Cell Reports 18:959-966. Zhang et al. (1999b) Plant Cell, Tissue and Organ Culture 56:37-46. Zhao et al. (1998) Nature Biotechnology 16:258 -261. Zheng et al (2003) The Plant Cell 15:1872-1887 Zolotukhin et al (1g96) J.
Virol. 70:4646-4654.

权利要求:
Claims (28)
[1]
1. Process for producing an industrial product, the process characterized by the fact that it comprises the steps of: i) obtaining a non-human organism or a part thereof having a total non-polar lipid content of at least 3% (w/w of dry weight or seed weight), ii) any of: a) converting at least part of the lipids in the non-human organism or part thereof from step (i) to the industrial product by application of heat, chemical or enzymatic means or any combination thereof, for the lipid in situ in the non-human organism or part thereof, or b) physically processing the non-human organism or part thereof from step (i) and subsequently or simultaneously converting at least part of the lipids in the organism non-human or part thereof processed for the industrial product by application of heat, chemical or enzymatic means or any combination thereof, for the lipids in the non-human organism or part thereof processed, and iii) recovering the product industrial, thus producing the industrial product.
[2]
2. Process according to claim 1, characterized in that the non-human organism or a part thereof comprises one or more exogenous polynucleotides, wherein each of the one or more exogenous polynucleotides is operably linked to a promoter that is capable of directing the expression of the polynucleotide in a non-human organism or a part thereof, and where the non-human organism or part thereof has an increased level of one or more non-polar lipids relative to a non-human organism or a part thereof. part of the same counterpart without one or more exogenous polynucleotides.
[3]
3. Process for the production of extracted lipids, the process characterized by the fact that it comprises the steps of: i) obtaining a non-human organism or a part thereof comprising one or more exogenous polynucleotides and an increased level of one or more non-polar lipids in relation to a non-human organism or a corresponding part thereof, respectively, without the one or more exogenous polynucleotides, ii) the extraction of lipid from the non-human organism or part thereof, and iii) recovery of the extracted lipid, thus producing the extracted lipid, in which each of the one or more exogenous polynucleotides is operably linked to a promoter that is capable of directing the expression of the polynucleotide in a non-human organism or part thereof, and in which one or more or all the following characteristics apply: (a) the one or more exogenous polynucleotides comprise a first exogenous polynucleotide encoding a transcription factor RNA or polypeptide that increases ta the expression of one or more genes of fatty acid biosynthesis in glycolytics in a non-human organism or a part thereof, and a second exogenous polynucleotide encoding an RNA or polypeptide involved in the biosynthesis of one or more non-polar lipids,
(b) if the non-human organism is a plant, a vegetative part of the plant has a total non-polar lipid content of at least about 3%, more preferably at least about 5%, preferably at least about 7%, more preferably at least about 10%, more preferably at least about 11%, more preferably at least about 12%, more preferably at least about 13%, more preferably at least about 14%, or more preferably at least about about 15% (w/w dry weight),
(c) the non-human organism is an algae selected from the group consisting of diatoms (bacillaryophytes), green algae (chlorophytes), blue-green algae (cyanophytes), golden brown algae (chrysophytes), haptophytes, brown algae and heterokont algae,
(d) the one or more non-polar lipids comprise a fatty acid comprising a hydroxyl group, an epoxy group, a cyclopropane group, a carbon-carbon double bond, a carbon-carbon triple bond, conjugated double bonds, a branched chain, as a methylated or hydroxylated branched chain, or a combination of two or more of them, or any of two, three, four,
five or six of the aforementioned groups, bonds or branched chains, (e) the total content of fatty acids in the non-polar lipids comprises at least 2% more oleic acid and/or at least 2% less palmitic acid than non-polar lipids in the corresponding non-human organism or part thereof without the one or more exogenous polynucleotides, (f) the non-polar lipids comprise a modified level of total sterols, preferably free sterols (non-esterified), sterol esters, sterol glycosides , in relation to the non-polar lipids in the corresponding non-human organism or part thereof without the one or more exogenous polynucleotides, (g) the non-polar lipids comprise waxes and/or wax esters, and (h) the non-human organism or part of it is a member of a grouped population or collection of at least about 1000 such non-human organisms or parts thereof, respectively, from which the lipid is extracted.
[4]
4. Process according to claim 3, characterized in that the one or more exogenous polynucleotides comprise the first exogenous polynucleotide and the second exogenous polynucleotide, and in which one or more or all of the characteristics (b) to (h) apply.
[5]
5. Process according to any one of claims 1 to 4, characterized in that:
(i) the non-human organism is a plant, an alga, or an organism suitable for fermentation, such as a fungus, or (ii) the non-human organism part is a seed, fruit, or a vegetative part of a plant.
[6]
6. Process for producing extracted canola oil, the process characterized in that it comprises the steps of: i) obtaining canola seed comprising at least 5% seed oil on a weight basis, ii) extracting seed oil from canola, and iii) recovering the oil, wherein the recovered oil comprises at least 90% (w/w) triacylglycerols (TAG), thereby producing the canola oil.
[7]
7. Process for producing extracted soybean oil, the process characterized in that it comprises the steps of: i) obtaining soybean seeds comprising at least 20% seed oil on a weight basis, ii) extracting oil from soybean seed, and iii) recovering the oil, wherein the recovered oil comprises at least 90% (w/w) of triacylglycerols (TAG), thereby producing the soybean oil.
[8]
8. Process according to any one of claims 1 to 7, characterized in that the step of physically processing comprises one or more of drying, rolling, pressing, crushing or grinding the non-human organism or part of it, or seed, and/or purify the extracted lipid or oil.
[9]
9. Process according to any one of claims 1 to 8, characterized in that the extracted or recovered lipid or oil comprises triacylglycerols, and in which the triacylglycerols comprise at least 90% (w/w) of the extracted lipid or oil.
[10]
10. Process according to any one of claims 1 to 9, characterized in that it comprises one or more of: a) recovering the extracted lipid or oil, collecting it in a container, b) one or more degumming, deodorize, discolor, dry, fractionate the extracted lipid or oil, c) removing at least some waxes and/or wax esters from the extracted lipid or oil, and d) analyzing the fatty acid composition of the extracted lipid or oil.
[11]
11. Process according to claim 1 or 2, characterized in that the industrial product is a hydrocarbon product, such as fatty acid esters, preferably fatty acid methyl esters and/or fatty acid ethyl esters, an alkane , such as methane, ethane or a longer-chain alkane, a mixture of longer-chain alkanes, an alkene, a biofuel, carbon monoxide and/or hydrogen gas, a bioalcohol such as ethanol, propanol or butanol, biochar ,
or a combination of carbon monoxide, hydrogen and biochar.
[12]
12. Process according to any one of claims 2 to 11, characterized in that one or more or all of the following characteristics apply: (i) the level of one or more non-polar lipids in the non-human organism or part of the same, or the seed is at least 0.5% higher on a weight basis relative to the level in a corresponding non-human organism or part thereof, or seed, respectively, without the one or more exogenous polynucleotides, (ii) the level of one or more non-polar lipids in the non-human organism or part thereof, the seed is at least 1% higher in relative terms than in a corresponding non-human organism or part thereof, or seed, respectively, without the one or more exogenous polynucleotides, (iii) the total non-polar lipid content in the non-human organism or part thereof, or seed is at least 0.5% higher based on weight relative to the level in a corresponding non-human organism or part thereof , or seed, respectively, without one or more exogenous polynucleotides, (iv) the total non-polar lipid content in the non-human organism or part thereof, or seed is at least 1% higher in relative terms than in a corresponding non-human organism or part thereof, or seed, respectively, without the one or more exogenous polynucleotides,
(v) the level of one or more non-polar lipids and/or the total non-polar lipid content of the non-human organism or part thereof, or seed is at least 0.5% higher on a weight basis and/or at least 1% higher on a relative basis than a corresponding non-human organism or a part thereof, or seed, respectively, which is lacking the one or more exogenous polynucleotides and which comprises an exogenous polynucleotide encoding an Arabidopis thaliana DGAT1,
(vi) the content of TAG, DAG, TAG and DAG, or MAG in the lipid in the non-human organism or part thereof, or in the seed and/or in the lipid or oil extracted from it is at least 10% higher on a relative basis than that the content of TAG, DAG, TAG and DAG, or MAG in the lipid or oil in a corresponding non-human organism or part thereof, or seed lacking the one or more exogenous polynucleotides, or a corresponding lipid or oil extracted therefrom, respectively , and
(vii) the total content of polyunsaturated fatty acid (PUFA) in the lipid in the non-human body or part of it, or in the seed and/or in the lipid or oil extracted from it is increased or decreased in relation to the total content of PUFA in the lipid or oil in a corresponding non-human organism or part thereof, or seed lacking the one or more exogenous polynucleotides, or a corresponding lipid or oil extracted therefrom, respectively,
(viii) oleic acid comprises at least 20% (%mol), at least 22% (%mol), at least 30% (%mol), at least 40% (%mol), at least 50% (%mol), or at least 60% (%mol), preferably at least 65%
(%mol) or at least 66% (%mol) of the total fatty acid content in the non-polar lipid or oil in the non-human organism or part thereof, or seed, and (ix) the non-polar lipid or oil in the non-human organism or part thereof, or seed comprises a fatty acid comprising a hydroxyl group, an epoxy group, a cyclopropane group, a carbon-carbon double bond, a carbon-carbon triple bond, conjugated double bonds, a branched chain, as a methylated or hydroxylated branched chain, or a combination of two or more thereof, or any two, three, four, five or six of the aforementioned groups, bonds or branched chains.
[13]
13. Process according to any one of claims 1 to 12, characterized in that the non-human organism or part thereof, or the seed comprises a first exogenous polynucleotide encoding an RNA or a transcription factor increasing polypeptide the expression of one or more fatty acid or glycolytic biosynthesis genes in a non-human organism or a part thereof, or a seed, respectively, and a second exogenous polynucleotide encoding an RNA or a polypeptide involved in the biosynthesis of one or more non-polar lipids, in which the first and second exogenous polynucleotides are each operably linked to a promoter that is capable of directing the expression of the polynucleotide in a non-human organism or a part thereof, or a seed, respectively.
[14]
14. Process according to claim 13, characterized in that the first exogenous polynucleotide encodes a Wrinkled transcription factor 1 (WRI1), a leafy cotyledon transcription factor 1 (Lecl), a leafy cotyledon transcription factor 2 (LEC2), a Fus3 transcription factor, an ABI3 transcription factor, a Dof4 transcription factor, a BABY BOOM (BBM) transcription factor, or a Dof11 transcription factor.
[15]
15. Process according to claim 13 or 14, characterized in that the second exogenous polynucleotide encodes a polypeptide having monoacylglycerol acyltransferase (MGAT) activity and/or diacylglycerol acyltransferase (DGAT) or glycerol-3-activity phosphate acyltransferase (GPAT).
[16]
16. Process according to any one of claims 13 to 15, characterized in that the non-human organism or part thereof, or the seed further comprises a third or more exogenous polynucleotides encoding one or more or any combination of: i) another transcription factor RNA or polypeptide that increases the expression of one or more fatty acid or glycolytic biosynthesis genes in the non-human organism or a part thereof, or seed, ii) another RNA or polypeptide involved in biosynthesis of one or more non-polar lipids, iii) a polypeptide that stabilizes the one or more non-polar lipids, preferably an oleosin, such as a polyoleosin or a kaleosin, more preferably a polyoleosin, iv) an RNA molecule that inhibits the expression of a gene encoding a polypeptide involved in starch biosynthesis, such as an AGPase polypeptide, v) an RNA molecule that inhibits the expression of a gene encoding an involved polypeptide from the degradation of lipids and/or which reduces the lipid content, such as a lipase, such as a CGi58 polypeptide, or vi) a silencing suppressor polypeptide, wherein the third or more exogenous polynucleotides are operably linked to a promoter that is capable of directing the expression of polynucleotides in a non-human organism or a part of it, or a seed, respectively.
[17]
17. Process according to any one of claims 1 to 16, characterized in that the non-human organism or part thereof, or the seed comprises one or more exogenous polynucleotides encoding: i) a Wrinkled 1 transcription factor ( WRI1) and a DGAT, ii) a transcription factor WRI1, a DGAT and an oleosin, iii) a transcription factor WRI1, a DGAT, a MGAT and an oleosin, iv) a monoacylglycerol acyltransferase (MGAT),
v) a diacylglycerol acyltransferase 2 (DGAT2), vi) a MGAT and a glycerol-3-phosphate acyltransferase (GPAT), vii) a MGAT and a DGAT, viii) a MGAT, a GPAT and a DGAT, ix) a factor of transcription WRI1 and one MGAT, x) one transcription factor WRI1, one DGAT and one MGAT, xi) one transcription factor WRI1, one DGAT, one MGAT, one oleosin and GPAT, xii) one DGAT and one oleosin, or xiii) an MGAT and an oleosin, and xiv) optionally, a silencing suppressor polypeptide, wherein each of the one or more exogenous polynucleotides is operably linked to a promoter that is capable of directing the expression of the polynucleotide in the non-human organism or part thereof. , or seed, respectively.
[18]
18. Recombinant cell, characterized in that it comprises a total non-polar lipid content of at least about 3%, more preferably at least about 5%, preferably at least about 7%, most preferably at least about 10 %, more preferably at least about 11%, more preferably at least about 12%, more preferably at least about 13%, more preferably at least about 14%, or more preferably at least about 15% (w/ p), wherein the non-polar lipid comprises at least 90% triacylglycerols (TAG), and wherein the cell comprises one or more exogenous polynucleotides and an increased level of one or more non-polar lipids relative to a cell without the one or more exogenous polynucleotides, wherein each of the one or more exogenous polynucleotides is operably linked to a promoter that is capable of directing expression of the polynucleotide in the cell, and wherein one or more or all of the following characteristics characteristics apply:
(i) the one or more exogenous polynucleotides comprise a first exogenous polynucleotide encoding a transcription factor RNA or polypeptide that enhances the expression of one or more fatty or glycolytic acid biosynthesis genes in the cell, and a second exogenous polynucleotide encoding an RNA or a polypeptide involved in the biosynthesis of one or more non-polar lipids,
(ii) if the cell is a cell from a vegetative part of a plant, the cell has a total non-polar lipid content of at least about 3%, more preferably at least about 5%, preferably at least about 7 %, more preferably at least about 10%, more preferably at least about 11%, more preferably at least about 12%, more preferably at least about 13%, more preferably at least about 14%, or more preferably at least about 15% (w/w),
(iii) the cell is an algae selected from the group consisting of diatoms (bacillaryophytes), green algae (chlorophytes), blue-green algae (cyanophytes), golden-brown algae (chrysophytes), haptophytes, brown algae and heterokont algae ,
(iv) non-polar lipids comprise a fatty acid comprising a hydroxyl group, an epoxy group, a cyclopropane group, a carbon-carbon double bond, a carbon-carbon triple bond, conjugated double bonds, a branched chain such as a chain methylated or hydroxylated branched, or a combination of two or more thereof, or any of two, three, four, five or six of the aforementioned groups, bonds or branched chains,
(v) the cell comprises oleic acid in an esterified or non-esterified form in its lipid where at least 20% (%mol), at least 22% (%mol), at least 30% (%mol), at least 40% (%mol), at least 50% (%mol), or at least 60% (%mol), preferably at least 65% (%mol) or at least 66% (%mol) of the total fatty acid content in the cell lipid is oleic acid,
(vi) the cell comprises oleic acid in a form esterified to its non-polar lipid in which at least 20% (%mol), at least 22% (%mol), at least 30% (%mol), at least less 40% (%mol), at least 50% (%mol), or at least 60% (%mol), preferably at least 65% (%mol) or at least 66% ( %mol) of the total fatty acid content in the non-polar lipid of the cell is oleic acid,
(vii) the total fatty acid content in the cell lipid comprises at least 2% more oleic acid and/or at least 2% less palmitic acid than the lipid in the corresponding cell without the one or more exogenous polynucleotides, (viii) the total content of fatty acids in the non-polar lipids of the cell comprises at least 2% more oleic acid and/or at least 2% less palmitic acid than the non-polar lipid in the corresponding cell without the one or plus exogenous polynucleotides, (ix) non-polar lipids comprise a modified level of total sterols, preferably free sterols, sterol esters and/or sterol glycosides, (x) non-polar lipids comprise waxes and/or wax esters, (xi) the cell is a member of a population or collection of at least about 1000 such cells, and (xii) if the cell is a cell from a vegetative part of a plant, the cell has a non-lipid content. polar totals of at least about 3%, more preferably by m less about 5%, preferably at least about 7%, more preferably at least about 10%, more preferably at least about 11%, more preferably at least about 12%, more preferably at least about 13%, more preferably at least about 14%, or more preferably at least about 15% (w/w).
[19]
19. Process to obtain a cell with greater capacity to produce one or more non-polar lipids, the process characterized by the fact that it comprises the steps of:
i) introduce into a cell one or more exogenous polynucleotides,
ii) express the one or more exogenous polynucleotides in the cell or a cell descendant thereof,
iii) analyzing the lipid content of the descendant cell or cell, and iv) selecting a descendant cell or cell that has an increase in the level of one or more non-polar lipids relative to a corresponding cell or descendant cell without the exogenous polynucleotides,
where the one or more exogenous polynucleotides encode:
i) a Wrinkled 1 transcription factor (WRI1) and a DGAT,
ii) a transcription factor WRI1, a DGAT and an oleosin,
iii) a transcription factor WRI1, a DGAT, a MGAT and an oleosin,
iv) a monoacylglycerol acyltransferase (MGAT),
v) a diacylglycerol acyltransferase 2 (DGAT2),
vi) an MGAT and a glycerol-3-phosphate acyltransferase (GPAT),
vii) one MGAT and one DGAT,
viii) one MGAT, one GPAT and one DGAT,
ix) a transcription factor WRI1 and an MGAT,
x) one transcription factor WRI1, one DGAT and one MGAT,
xi) a transcription factor WRI1, one DGAT, one MGAT, one oleosin and GPAT, xii) one DGAT and one oleosin, or xiii) one MGAT and one oleosin, and xiv) optionally, a silencing suppressor polypeptide, where each exogenous polynucleotide is operably linked to a promoter that is capable of directing expression of the exogenous polynucleotide in the descendant cell or cell.
[20]
20. Use of one or more polynucleotides, or a genetic construct comprising polynucleotides, characterized in that they encode: i) a Wrinkled 1 transcription factor (WRI1) and a DGAT, ii) a transcription factor WRI1, a DGAT and a oleosin, iii) a transcription factor WRI1, one DGAT, one MGAT and one oleosin, iv) one monoacylglycerol acyltransferase (MGAT), v) one diacylglycerol acyltransferase 2 (DGAT2), vi) one MGAT and one glycerol-3-phosphate acyltransferase (GPAT), vii) one MGAT and one DGAT, viii) one MGAT, one GPAT and one DGAT, ix) one transcription factor WRI1 and one MGAT, x) one transcription factor WRI1, one DGAT and one MGAT,
xi) a transcription factor WRI1, one DGAT, one MGAT, one oleosin and GPAT, xii) one DGAT and one oleosin, or xiii) one MGAT and one oleosin, and xiv) optionally, a silencing suppressor polypeptide, to produce a transgenic cell, a transgenic non-human organism or a part thereof, or a transgenic seed having a greater capacity to produce one or more non-polar lipids than a cell, non-human organism or part thereof, or corresponding seed without the one or plus polynucleotides, in which each of the one or more polynucleotides is exogenous to the cell, non-human organism or part thereof, or seed and is operably linked to a promoter that is capable of directing the expression of the polynucleotide in a cell, a non-organism human or a part of it, or a seed, respectively.
[21]
21. Use of a first polynucleotide encoding a transcription factor RNA or polypeptide that increases the expression of one or more fatty acid or glycolitic acid biosynthesis genes in a cell, a non-human organism or a part thereof, or a seed, together with a second polynucleotide encoding an RNA or a polypeptide involved in the biosynthesis of one or more non-polar lipids, characterized in that it is to produce a transgenic cell, a transgenic non-human organism or part thereof, or a transgenic seed having a greater ability to produce one or more non-polar lipids relative to a cell, non-human organism or part thereof, or corresponding seed without the first and second polynucleotides, wherein the first and second polynucleotides are each exogenous to the cell, organism non-human or part thereof, or seed and are each operably linked to a promoter that is capable of directing the expression of the polynucleotide n the transgenic cell, transgenic non-human organism or part thereof, or transgenic seeds, respectively.
[22]
22. Process for producing seed, the process characterized in that it comprises: i) growing a plant, and ii) collecting seed from the plant, wherein the seed comprises a cell as defined in claim 18.
[23]
23. Recovered or extracted lipid, characterized in that it is obtainable by the process, as defined in any one of claims 3 to 17, or obtainable by the cell, as defined in claim 18, or a non-human organism comprising the cell, or the seed produced by the process as defined in claim 22.
[24]
24. Industrial product produced by the process as defined in any one of claims 1, 2 or 11 to 17, characterized in that it is a hydrocarbon product, such as fatty acid esters, preferably methyl esters of fatty acids and/or ethyl esters of fatty acids, an alkane such as methane, ethane or a longer-chain alkane, a mixture of longer-chain alkanes, an alkene, a biofuel, carbon monoxide and/or hydrogen gas, a bioalcohol such as ethanol, propanol, or butanol, biochar, or a combination of carbon monoxide, hydrogen, and biochar.
[25]
25. Process for producing fuel, the process characterized in that it comprises: i) reacting the lipid, as defined in claim 23, with an alcohol, optionally, in the presence of a catalyst, to produce the alkyl esters, and ii) optionally, mixing the alkyl esters with petroleum-based fuel.
[26]
26. Process for producing a synthetic diesel fuel, the process characterized in that it comprises: i) converting the lipid in the cell, as defined in claim 18, or a non-human organism comprising the cell or seed produced by the process, as defined in claim 22, to a synthesis gas by gasification, and ii) converting a synthesis gas to a biofuel using a metal catalyst or a microbial catalyst.
[27]
27. Process for producing a biofuel, the process characterized in that it comprises converting the lipid into the cell, as defined in claim 18, or a non-human organism comprising the cell, or the seed produced by the process, as defined in claim 22, to a bio-oil by pyrolysis, a bioalcohol by fermentation, or biogas by gasification or anaerobic digestion.
[28]
28. Process for producing a food ingredient, the process characterized in that it comprises mixing the cell, as defined in claim 18, or a non-human organism comprising the cell, or the seed produced by the process, as defined in claim 22, or the recovered or extracted lipid as defined in claim 23, or an extract or portion thereof, with at least one other food ingredient.

类似技术:

---

公开号 | 公开日 | 专利标题

---

JP2019088285A|2019-06-13|Processes for producing lipids

---

US10246718B2|2019-04-02|Processes for producing lipids

---

US20200080022A1|2020-03-12|Processes for producing industrial products from plant lipids

---

WO2018039740A9|2019-09-26|Plants with modified traits

---

WO2017117633A1|2017-07-13|Plants with modified traits

---

AU2021240309A1|2021-10-28|Processes for producing lipids

---

US20190300894A1|2019-10-03|Processes for producing lipids

---

AU2018201932A1|2019-10-03|Plants producing modified levels of medium chain fatty acids

---

NZ627107B2|2017-03-24|Processes for producing lipids

同族专利:

---

公开号 | 公开日

---

US8735111B2|2014-05-27|

---

CA2860434A1|2013-07-04|

---

US20190203125A1|2019-07-04|

---

US20170037320A1|2017-02-09|

---

PH12014501474A1|2014-10-08|

---

US20130164798A1|2013-06-27|

---

US10246641B2|2019-04-02|

---

NZ627107A|2016-12-23|

---

BR112014015921A8|2017-07-04|

---

CN104271743B|2019-11-05|

---

US9512438B2|2016-12-06|

---

RU2014131059A|2016-02-20|

---

JP2015511118A|2015-04-16|

---

RU2018116488A3|2021-12-28|

---

CL2014001715A1|2015-04-24|

---

CN104271743A|2015-01-07|

---

WO2013096993A1|2013-07-04|

---

UA119739C2|2019-08-12|

---

AR089442A1|2014-08-20|

---

US9061992B2|2015-06-23|

---

RU2656996C2|2018-06-07|

---

AU2012324024B2|2016-06-16|

---

AU2012324024A1|2013-07-11|

---

JP2019088285A|2019-06-13|

---

CN110951769A|2020-04-03|

---

MX2014007964A|2014-10-06|

---

MX2019005692A|2019-09-05|

---

EP2798066A4|2016-02-24|

---

RU2018116488A|2018-10-23|

---

JP6461604B2|2019-01-30|

---

US20140256006A1|2014-09-11|

---

US20150267216A1|2015-09-24|

---

EP2798066A1|2014-11-05|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US4102938A|1977-03-02|1978-07-25|Kalur Vijaya Chandra Rao|Production of hydrocarbons by thermolysis of vegetable oils|

---

US4399216A|1980-02-25|1983-08-16|The Trustees Of Columbia University|Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials|

---

WO1984002913A1|1983-01-17|1984-08-02|Monsanto Co|Chimeric genes suitable for expression in plant cells|

---

US5504200A|1983-04-15|1996-04-02|Mycogen Plant Science, Inc.|Plant gene expression|

---

CA1338902C|1986-02-27|1997-02-11|Howard M. Goodman|Plant cells resistant to herbicidal glutamine synthetase inhibitors|

---

MA20977A1|1986-05-19|1987-12-31|Ciba Geigy Ag|Plants tolerant to herbicides containing the gluthathione S-Transferase gene|

---

US5188958A|1986-05-29|1993-02-23|Calgene, Inc.|Transformation and foreign gene expression in brassica species|

---

US5177010A|1986-06-30|1993-01-05|University Of Toledo|Process for transforming corn and the products thereof|

---

US5420034A|1986-07-31|1995-05-30|Calgene, Inc.|Seed-specific transcriptional regulation|

---

CN87100603A|1987-01-21|1988-08-10|昂科公司|Vaccines against melanoma|

---

SE455438B|1986-11-24|1988-07-11|Aga Ab|SET TO REDUCE A BURNER'S FLAME TEMPERATURE AND BURNER WITH THE OXYGEN RESP FUEL NOZZLE|

---

US5004863B2|1986-12-03|2000-10-17|Agracetus|Genetic engineering of cotton plants and lines|

---

US4948811A|1988-01-26|1990-08-14|The Procter & Gamble Company|Salad/cooking oil balanced for health benefits|

---

US4992605A|1988-02-16|1991-02-12|Craig Wayne K|Production of hydrocarbons with a relatively high cetane rating|

---

US5416011A|1988-07-22|1995-05-16|Monsanto Company|Method for soybean transformation and regeneration|

---

US5932479A|1988-09-26|1999-08-03|Auburn University|Genetic engineering of plant chloroplasts|

---

US5034323A|1989-03-30|1991-07-23|Dna Plant Technology Corporation|Genetic engineering of novel plant phenotypes|

---

EP0485506B1|1989-08-09|1997-11-12|DeKalb Genetics Corporation|Methods and compositions for the production of stably transformed, fertile maize plants and cells thereof|

---

GB2237815B|1989-11-06|1994-01-05|Univ Singapore|Production of synthetic crude petroleum|

---

DK0472712T3|1990-03-16|2002-01-14|Calgene Llc|Sequences Preferably Expressed in Early Seed Development and Related Methods|

---

US5877402A|1990-05-01|1999-03-02|Rutgers, The State University Of New Jersey|DNA constructs and methods for stably transforming plastids of multicellular plants and expressing recombinant proteins therein|

---

US5451513A|1990-05-01|1995-09-19|The State University of New Jersey Rutgers|Method for stably transforming plastids of multicellular plants|

---

US6483008B1|1990-08-15|2002-11-19|Calgene Llc|Methods for producing plants with elevated oleic acid content|

---

KR100191015B1|1991-01-16|1999-06-15|사토 야스히로|Chilling resistant plants and their production|

---

US5518908A|1991-09-23|1996-05-21|Monsanto Company|Method of controlling insects|

---

WO1993010240A1|1991-11-15|1993-05-27|E.I. Du Pont De Nemours And Company|β-KETOACYL-ACP SYNTHETASE II GENES FROM PLANTS|

---

US5593874A|1992-03-19|1997-01-14|Monsanto Company|Enhanced expression in plants|

---

EP0688160B1|1993-03-11|1998-05-13|National Research Council Of Canada|Enhanced regeneration system for cereals|

---

CA2092588C|1993-03-26|2008-07-08|Narender S. Nehra|Enhanced regeneration system for cereals|

---

US5362865A|1993-09-02|1994-11-08|Monsanto Company|Enhanced expression in plants using non-translated leader sequences|

---

GB9324707D0|1993-12-02|1994-01-19|Olsen Odd Arne|Promoter|

---

GB9403512D0|1994-02-24|1994-04-13|Olsen Odd Arne|Promoter|

---

US5545818A|1994-03-11|1996-08-13|Calgene Inc.|Expression of Bacillus thuringiensis cry proteins in plant plastids|

---

DE4433307A1|1994-09-19|1996-03-21|Norddeutsche Pflanzenzucht Han|An isolated nucleic acid fragment and products derived from it|

---

GB9510927D0|1995-05-31|1995-07-26|Ca Nat Research Council|Plant and seed oil modification|

---

US5939288A|1995-06-07|1999-08-17|Iowa State University Research Foundation, Inc.|Plant secretory signal peptides and nectarins|

---

GB9515941D0|1995-08-03|1995-10-04|Zeneca Ltd|DNA constructs|

---

GB9524938D0|1995-12-06|1996-02-07|Zeneca Ltd|Modification of starch synthesis in plants|

---

TR199800294T1|1996-06-21|1999-10-21|Monsanto Company|Efficient methods of wheat production with constant transformation.|

---

US7109392B1|1996-10-09|2006-09-19|Cargill, Incorporated|Methods for increasing oleic acid content in seeds from transgenic plants containing a mutant delta 12 desaturase|

---

US5977436A|1997-04-09|1999-11-02|Rhone Poulenc Agrochimie|Oleosin 5' regulatory region for the modification of plant seed lipid composition|

---

US6432684B1|1997-04-11|2002-08-13|Abbott Laboratories|Human desaturase gene and uses thereof|

---

US7589253B2|1997-04-15|2009-09-15|Commonwealth Scientific And Industrial Research Organisation|Fatty acid epoxygenase genes from plants and uses therefor in modifying fatty acid metabolism|

---

PL194095B1|1997-04-15|2007-04-30|Commw Scient Ind Res Org|Plant fatty acid epoxygenase genes and their application|

---

US6235529B1|1997-04-29|2001-05-22|The Regents Of The University Of California|Compositions and methods for plant transformation and regeneration|

---

EP1003882A1|1997-06-05|2000-05-31|Calgene LLC|Diacylglycerol acyl transferase proteins|

---

AR015136A1|1997-07-23|2001-04-18|Sanford Scient Inc|TRANSFORAMATION OF PLASTIDES IMPROVED OF SUPERIOR PLANTS AND PRODUCTION OF TRANSGENIC PLANTS WITH RESISTANCE TO HERBICIDES|

---

ES2321248T3|1997-09-12|2009-06-03|Commonwealth Scientific And Industrial Research Organisation|REGULATION OF GENE EXPRESSION IN PLANTS.|

---

DE69836552T3|1997-09-30|2014-10-09|The Regents Of The University Of California|PREPARATION OF PROTEINS IN PLANT SEEDS|

---

US6506559B1|1997-12-23|2003-01-14|Carnegie Institute Of Washington|Genetic inhibition by double-stranded RNA|

---

US6100447A|1998-02-12|2000-08-08|Applied Phytologics, Inc.|Method of barley transformation|

---

WO1999049029A1|1998-03-20|1999-09-30|Benitec Australia Ltd|Control of gene expression|

---

EP2316949B1|1998-03-20|2015-04-22|E. I. du Pont de Nemours and Company|Limnanthes oil genes|

---

DK1068311T3|1998-04-08|2011-08-08|Commw Scient Ind Res Org|Methods and means for obtaining modified phenotypes|

---

WO1999067268A1|1998-06-24|1999-12-29|The Regents Of The University Of California|Diacylglycerol o-acyltransferase|

---

US6344548B1|1998-06-24|2002-02-05|The Regents Of The University Of California|Diacylglycerol o-acyltransferase|

---

US7135617B2|1998-07-02|2006-11-14|Calgene Llc|Diacylglycerol acyl transferase proteins|

---

EP1098962B1|1998-07-02|2009-09-09|Calgene LLC|Diacylglycerol acyl transferase proteins|

---

BR9913382A|1998-08-20|2001-09-25|Du Pont|Isolated nucleic acid fragments encoding a vegetable fatty acid-modifying enzyme associated with the formation of conjugated double unions, chimeric genes, transformed host cells, seeds, oils, methods of changing the level of fatty acids with conjugated double unions in a host cell , methods of producing oil from seeds containing fatty acids with conjugated double unions in plant seeds, methods of producing fatty acid-modifying enzymes associated with the formation of conjugated double unions, methods of isolating nucleic acid fragments and their subfragments functionally coding equivalents of a vegetable fatty acid-modifying enzyme associated with the formation of conjugated double joints, animal feed, methods of improving the quality of an animal's carcass and complement|

---

US6100077A|1998-10-01|2000-08-08|The Trustees Of Columbia University In The City Of New York|Isolation of a gene encoding diacylglycerol acyltransferase|

---

EP1135473A2|1998-12-02|2001-09-26|E.I. Dupont De Nemours And Company|Sequenzes of a putative plant diacylglycerol acyltransferases|

---

AU2166400A|1998-12-04|2000-06-19|Calgene Llc|Diacylglycerol acyl transferase proteins|

---

AU779969B2|1998-12-17|2005-02-24|National Research Council Of Canada|Diacylglycerol acyltransferase gene from plants|

---

DE60033793T2|1999-04-01|2007-12-06|Basf Plant Science Gmbh|ENZYMES OF THE TRIACYLGLYCEROL BIOSYNTHESIS PATH AND RECOMBINANT DNA MOLECULES CODING THEREOF|

---

AU784352B2|1999-05-04|2006-03-16|Cargill Incorporated|Plant acyltransferases|

---

DE19941609A1|1999-09-01|2001-03-08|Inst Pflanzenbiochemie Ipb|Fatty acid desaturase gene from plants|

---

DE19950589A1|1999-10-20|2001-05-23|Gvs Ges Fuer Erwerb Und Verwer|Elongase promoters for tissue-specific expression of transgenes in plants|

---

US6326193B1|1999-11-05|2001-12-04|Cambria Biosciences, Llc|Insect control agent|

---

DE60142734D1|2000-04-18|2010-09-16|Commw Scient Ind Res Org|METHOD OF MODIFYING THE COTTON OIL CONTENT|

---

US20030161831A1|2001-02-23|2003-08-28|Sylvaine Cases|Mono-and diacylglycerol acyltransferases and methods of use thereof|

---

US7045326B2|2001-02-23|2006-05-16|The Regents Of The University Of California|Mono- and diacylglycerol acyltransferases and methods of use thereof|

---

AT404672T|2001-06-06|2008-08-15|Bioriginal Food & Science Corp|SEED-SPECIFIC SEQUENCES OF FLAX |

---

CN1617880A|2001-12-21|2005-05-18|密执安州立大学|Plant cyclopropane fatty acid synthase genes, proteins and uses thereof|

---

CA2519169C|2002-03-16|2013-04-30|The University Of York|Transgenic plants expressing enzymes involved in fatty acid biosynthesis|

---

US7566813B2|2002-03-21|2009-07-28|Monsanto Technology, L.L.C.|Nucleic acid constructs and methods for producing altered seed oil compositions|

---

EP1516056A4|2002-06-21|2005-12-28|Monsanto Technology Llc|Thioesterase-related nucleic acid sequences and methods of use for the production of plants with modified fatty acid composition|

---

WO2004011671A2|2002-07-31|2004-02-05|Monsanto Technology, Llc|Diacylglycerol acyltransferase nucleic acid sequences and associated products|

---

AU2003298548A1|2002-08-12|2004-05-25|Monsanto Technology Llc|Methods for increasing total oil levels in plants|

---

US7267976B2|2003-07-02|2007-09-11|E.I. Du Pont De Nemours And Company|Acyltransferases for alteration of polyunsaturated fatty acids and oil content in oleaginous yeasts|

---

WO2005063988A1|2003-12-23|2005-07-14|Pioneer Hi-Bred International, Inc.|Alteration of oil traits in plants|

---

ES2715640T3|2004-04-22|2019-06-05|Commw Scient Ind Res Org|Synthesis of long chain polyunsaturated fatty acids by recombinant cells|

---

CN102559364B|2004-04-22|2016-08-17|联邦科学技术研究组织|Use recombinant cell synthesis of long-chain polyunsaturated fatty acids|

---

US8685679B2|2004-11-04|2014-04-01|E I Du Pont De Nemours And Company|Acyltransferase regulation to increase the percent of polyunsaturated fatty acids in total lipids and oils of oleaginous organisms|

---

EP1806398A1|2006-01-04|2007-07-11|Monsanto S.A.S.|Fad-2 mutants and high oleic plants|

---

EP1991047B1|2006-03-01|2012-09-26|Pioneer Hi-Bred International Inc.|Compositions related to the quantitative trait locus 6 in maize and methods of use|

---

GB2436068A|2006-03-18|2007-09-19|Ernest Mark Talbot|Surgical contact lens|

---

EP1837397A1|2006-03-21|2007-09-26|Monsanto S.A.S.|FAD-2 mutants and high oleic plants|

---

WO2008006171A1|2006-07-14|2008-01-17|Commonwealth Scientific And Industrial Research Organisation|Altering the fatty acid composition of rice|

---

US8816106B2|2006-08-29|2014-08-26|Commonwealth Scientific And Industrial Research Organisation|Synthesis of fatty acids|

---

US20090061492A1|2006-11-15|2009-03-05|The Board Of Trustees For Michigan State University System|Method for producing biodiesel|

---

EP1944375A1|2007-01-11|2008-07-16|Monsanto S.A.S.|FAD2 mutants and high oleic acid plants|

---

EP2109670A1|2007-01-25|2009-10-21|Danisco A/S|Production of a lipid acyltransferase from transformed bacillus licheniformis cells|

---

NZ554114A|2007-04-23|2010-01-29|Agres Ltd|Plants with an increased ratio of oleosin to TAG synthesising enzymes|

---

WO2008157226A2|2007-06-15|2008-12-24|Hilary Koprowski|Engineered plant biomass with increased oil production|

---

WO2008157827A2|2007-06-21|2008-12-24|Michigan State University|Modified composition of plant extracellular lipids using acyltransferases and fatty acid omega-oxidases|

---

WO2009027335A2|2007-08-28|2009-03-05|Basf Plant Science Gmbh|Polypeptides, such as lipases, capable of altering the seed storage content in transgenic plants|

---

AU2008333824A1|2007-12-04|2009-06-11|The Ohio State University Research Foundation|Molecular approaches for the optimization of biofuel production|

---

WO2009129582A1|2008-04-25|2009-10-29|Commonwealth Scientific Industrial Research Organisation|Polypeptides and methods for producing triacylglycerols comprising modified fatty acids|

---

WO2009129583A1|2008-04-25|2009-10-29|Commonwealth Scientific Industrial Research Organisation|Recombinant cells and methods for hydroxylating fatty acids|

---

EP2297310A2|2008-05-23|2011-03-23|E. I. du Pont de Nemours and Company|Novel dgat genes for increased seed storage lipid production and altered fatty acid profiles in oilseed plants|

---

US8143476B2|2008-05-23|2012-03-27|E I Du Pont De Nemours And Company|DGAT genes from Yarrowia lipolytica combined with plastidic phosphoglucomutase down regulation for increased seed storage lipid production and altered fatty acid profiles in oilseed plants|

---

ES2603530T3|2008-07-21|2017-02-28|Commonwealth Scientific And Industrial Research Organisation|Improved cottonseed oil and uses|

---

AU2009273755A1|2008-07-21|2010-01-28|Commonwealth Scientific And Industrial Research Organisation|Improved vegetable oils and uses therefor|

---

CN114045301A|2008-11-18|2022-02-15|联邦科学技术研究组织|Enzymes and methods for producing omega-3 fatty acids|

---

US8507754B2|2009-01-31|2013-08-13|University Of North Texas|Engineering lipids in vegetative tissues of plants|

---

US8993840B2|2009-11-23|2015-03-31|E I du Pont de Nemours and Compay|Sucrose transporter genes for increasing plant seed lipids|

---

WO2011100272A1|2010-02-09|2011-08-18|Syngenta Participations Ag|Systems and processes for producing biofuels from biomass|

---

EP2585589B1|2010-06-28|2017-06-21|Commonwealth Scientific and Industrial Research Organisation|Methods of producing lipids|

---

US8657999B2|2010-07-28|2014-02-25|General Electric Company|Methods for preparing fuel compositions from renewable sources, and related systems|

---

AU2012294956B2|2011-08-05|2017-05-18|Agresearch Limited|Methods for increasing CO2 assimilation and oil production in photosynthetic organisms|

---

US8809026B2|2011-12-27|2014-08-19|Commonwealth Scientific And Industrial Research Organisation|Processes for producing lipids|

---

EP2798066A4|2011-12-27|2016-02-24|Commw Scient Ind Res Org|Processes for producing lipids|

---

CA2860416A1|2011-12-27|2013-07-04|Commonwealth Scientific And Industrial Research Organisation|Production of dihydrosterculic acid and derivatives thereof|WO2008006171A1|2006-07-14|2008-01-17|Commonwealth Scientific And Industrial Research Organisation|Altering the fatty acid composition of rice|

---

WO2009129582A1|2008-04-25|2009-10-29|Commonwealth Scientific Industrial Research Organisation|Polypeptides and methods for producing triacylglycerols comprising modified fatty acids|

---

AU2009273755A1|2008-07-21|2010-01-28|Commonwealth Scientific And Industrial Research Organisation|Improved vegetable oils and uses therefor|

---

ES2603530T3|2008-07-21|2017-02-28|Commonwealth Scientific And Industrial Research Organisation|Improved cottonseed oil and uses|

---

US8772004B2|2009-06-25|2014-07-08|Old Dominion University Research Foundation|System and method for high-voltage pulse assisted aggregation of algae|

---

EP2585589B1|2010-06-28|2017-06-21|Commonwealth Scientific and Industrial Research Organisation|Methods of producing lipids|

---

CN103781889B|2011-08-09|2016-05-25|蓝宝石能源公司|The composition of the material of the algae oil that comprises extraction|

---

EP2798066A4|2011-12-27|2016-02-24|Commw Scient Ind Res Org|Processes for producing lipids|

---

US8809026B2|2011-12-27|2014-08-19|Commonwealth Scientific And Industrial Research Organisation|Processes for producing lipids|

---

BR112014026900A2|2012-04-25|2017-07-11|Commw Scient Ind Res Org|oils with high oleic acid content|

---

CN110478342A|2012-05-10|2019-11-22|索卢泰克斯Na有限责任公司|Contain the natural special oil with anti-inflammatory activity for promoting recession medium and its precursor|

---

US9657304B2|2012-07-10|2017-05-23|Board Of Trustees Of Michigan State University|Genetically engineered plants with increased vegetative oil content|

---

US8709250B2|2012-07-12|2014-04-29|Heliae Development, Llc|Tubular electro-acoustic aggregation device|

---

US8668827B2|2012-07-12|2014-03-11|Heliae Development, Llc|Rectangular channel electro-acoustic aggregation device|

---

US8702991B2|2012-07-12|2014-04-22|Heliae Development, Llc|Electrical microorganism aggregation methods|

---

US8673154B2|2012-07-12|2014-03-18|Heliae Development, Llc|Tunable electrical field for aggregating microorganisms|

---

US8709258B2|2012-07-12|2014-04-29|Heliae Development, Llc|Patterned electrical pulse microorganism aggregation|

---

US10253325B2|2012-12-19|2019-04-09|Boston Medical Center Corporation|Methods for elevating fat/oil content in plants|

---

CN105247038B|2013-03-15|2021-08-27|小利兰·斯坦福大学托管委员会|Microorganisms that produce benzylisoquinoline alkaloidsand methods of making and using the same|

---

PT3022290T|2013-07-19|2018-04-02|Fermentalg|Modified algae strain and method of triacylglycerol accumulation using said strain|

---

CN105636974A|2013-08-14|2016-06-01|堪萨斯州立大学研究基金会|Expression of thermostable starch synthase genes improves the yield in heat stress|

---

AU2014308688A1|2013-08-21|2016-04-07|Brookhaven Science Associates, Llc|Transformation of duckweed and uses thereof|

---

US9394503B2|2013-10-15|2016-07-19|The Board Of Trustees Of The University Of Illinois|Separation process of oil and sugars from biomass|

---

CA2965469A1|2013-11-04|2015-05-07|The Board Of Trustees Of The Leland Stanford Junior University|Benzylisoquinoline alkaloidprecursor producing microbes, and methods of making and using the same|

---

US9365780B2|2014-02-19|2016-06-14|King Abdulaziz City For Science And Technology|Cold process for removal of sulfur in straight run diesel by ozone and tert-butyl hydroperoxide|

---

US20150322468A1|2014-05-07|2015-11-12|Arizona Board Of Regents On Behalf Of Arizona State University|Method of producing biofuel using microalgae cultures|

---

PT107637A|2014-05-15|2015-11-16|Inst Superior Técnico|PRODUCTION OF FUELS USING MICROBIAL GLYCOLIPIDS WITH LIPIDIC CHAINS COMPOSED FOR 6 TO 14 CARBONES|

---

US9593344B2|2014-07-03|2017-03-14|Brookhaven Science Associates, Llc|Enhanced triacylglycerol accumulation in vegetative tissues of plants|

---

WO2016004473A1|2014-07-07|2016-01-14|Commonwealth Scientific And Industrial Research Organisation|Processes for producing industrial products from plant lipids|

---

US9643163B2|2014-10-10|2017-05-09|Crystaphase Products, Inc.|Heterogeneous catalyst for transesterification and method of preparing same|

---

CN105092771B|2015-03-23|2017-04-26|广东省第二中医院（广东省中医药工程技术研究院）|Thin-layer chromatography rapid identification method for Pothos chinensis|

---

US10144696B2|2015-04-17|2018-12-04|Crystaphase Products, Inc.|Heterogeneous catalyst for transesterification and method of preparing same|

---

CA2983419A1|2015-05-04|2016-11-10|The Board Of Trustees Of The Leland Stanford Junior University|Benzylisoquinoline alkaloidprecursor producing microbes, and methods of making and using the same|

---

WO2017011707A1|2015-07-14|2017-01-19|Synthetic Genomics, Inc|Microorganisms having increased lipid productivity|

---

WO2017041094A1|2015-09-03|2017-03-09|Solutex Na Llc|Compositions comprising omega-3 fatty acids, 17-hdha and 18- hepe and methods of using same|

---

CA3010724A1|2016-01-07|2017-07-13|Commonwealth Scientific And Industrial Research Organisation|Plants with modified traits|

---

RU2019109455A3|2016-09-02|2021-06-17|

---

KR101743117B1|2016-02-03|2017-06-02|전남대학교산학협력단|AtWRI1 gene from Arabidopsis thaliana for increasing seed mass, size and storage oil content of camelina plant and uses thereof|

---

US10328361B2|2016-02-25|2019-06-25|Jeffrey M. Skell|Extracting substances from botanical matter|

---

JP2019512039A|2016-02-26|2019-05-09|ゴラス，ネイサン|High alpha linolenic acid flax|

---

CN110129298B|2016-06-02|2021-08-03|天津科技大学|Phospholipase D mutant and application thereof|

---

FR3052459B1|2016-06-13|2020-01-24|Bio-Think|MIXTURE FOR SUPPLYING A BOILER OR DIESEL ENGINE COMPRISING PARTICULAR ESTERS AND ALKANES|

---

CN106676083B|2016-11-14|2020-06-16|浙江大学|Lipase extraction method|

---

CN108265090B|2016-12-30|2021-06-15|中粮集团有限公司|Preparation method of antarctic krill oil substitute|

---

BR112020002050A2|2017-08-03|2020-09-08|Antheia, Inc.|engineered epimerases benzylisoquinoline alkaloids and production methods of benzylisoquinoline alkaloids|

---

CN109722451A|2017-10-27|2019-05-07|西北农林科技大学|The solid biologic film accelerator for anaerobic digestion and preparation method thereof that charcoal mediates|

---

CN108070603B|2017-12-28|2021-06-08|洛阳健特药业有限公司|Transgenic method for improving oil content of oil peony seeds|

---

CN108342349A|2018-03-20|2018-07-31|中国科学院烟台海岸带研究所|The method for largely accumulating grease using various plants hormone induction Phaeodactylum tricornutum|

---

CN108587916B|2018-05-23|2021-09-14|昆明理工大学|Method for quickly flocculating co-cultured monoraphidium under neutral condition|

---

CN108728448B|2018-06-04|2020-06-09|青岛农业大学|Peanut oil synthesis related gene and application thereof|

---

CN108802245B|2018-06-06|2021-06-22|四川新绿色药业科技发展有限公司|Method for detecting trichosanthes root or medicine prepared by taking trichosanthes root as raw material|

---

CA3116718A1|2018-10-17|2020-04-23|Perfect Day, Inc.|Recombinant components and compositions for use in food products|

---

CN110106019A|2019-05-20|2019-08-09|无限极（中国）有限公司|The method that pot algae produces compound polyunsaturated fatty acid grease is split in a kind of utilization|

---

CN110295153A|2019-07-05|2019-10-01|中国农业大学|A kind of encoding gene of glycerol-3-phosphate acyltransferase and its application|

---

CN112239493A|2020-11-17|2021-01-19|西南大学|Chimonanthus praecox CpWRI-L4 gene and protein coded by same and application of gene|

法律状态:
2018-03-27| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-08-13| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-06-01| B15I| Others concerning applications: loss of priority|Free format text: PERDA DA PRIORIDADE US 61/580,590 E 61/718,563 REIVINDICADAS NO PCT/AU2012/001598, CONFORME AS DISPOSICOES PREVISTAS NA LEI 9.279 DE 14/05/1996 (LPI) ART. 167O, ITEM 28 DO ATO NORMATIVO 128/97 E NO ART. 29 DA RESOLUCAO INPI-PR 77/2013. ESTA PERDA SE DEU PELO FATO DE O DEPOSITANTE CONSTANTE DA PETICAO DE REQUERIMENTO DO PEDIDO PCT SER DISTINTO DAQUELES QUE DEPOSITARAM A PRIORIDADE REIVINDICADA E NAO APRESENTOU DOCUMENTO DE CESSAO REGULARIZADO DENTRO DO PRAZO DE 60 DIAS A CONTAR DA DATA DA PUBLICACAO DA EXIGENCIA, CONFORME AS DISPOSICOES PREVISTAS NA LEI 9.279 DE 14/05/1996 (LPI) ART. 166O, ITEM 27 DO ATO NORMATIVO 128/97 E NO ART. 28 DA RESOLUCAO INPI-PR 77/2013. |

---

2021-06-01| B350| Update of information on the portal [chapter 15.35 patent gazette]|

---

2021-06-29| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

---

2021-08-10| B12F| Other appeals [chapter 12.6 patent gazette]|Free format text: RECURSO: 870210069110 - 29/07/2021 |

---

2021-12-21| B09B| Patent application refused [chapter 9.2 patent gazette]|

---

2022-03-03| B12B| Appeal against refusal [chapter 12.2 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161580590P| true| 2011-12-27|2011-12-27|

---

US61/580,590|2011-12-27|

---

US201261718563P| true| 2012-10-25|2012-10-25|

---

US61/718,563|2012-10-25|

---

PCT/AU2012/001598|WO2013096993A1|2011-12-27|2012-12-21|Processes for producing lipids|

---